Go to main content

マニュアルページ セクション 1: ユーザーコマンド

印刷ビューの終了

更新: 2022年7月27日
 
 

parallel (1)

名前

parallel - build and execute shell command lines from standard input in parallel

形式

parallel [options] [command [arguments]] < list_of_arguments

parallel [options] [command [arguments]] ( ::: arguments | :::+
arguments | :::: argfile(s) | ::::+ argfile(s) ) ...

parallel --semaphore [options] command

#!/usr/bin/parallel --shebang [options] [command [arguments]]

#!/usr/bin/parallel --shebang-wrap [options] [command [arguments]]

説明

PARALLEL(1)                        parallel                        PARALLEL(1)



NAME
       parallel - build and execute shell command lines from standard input in
       parallel

SYNOPSIS
       parallel [options] [command [arguments]] < list_of_arguments

       parallel [options] [command [arguments]] ( ::: arguments | :::+
       arguments | :::: argfile(s) | ::::+ argfile(s) ) ...

       parallel --semaphore [options] command

       #!/usr/bin/parallel --shebang [options] [command [arguments]]

       #!/usr/bin/parallel --shebang-wrap [options] [command [arguments]]

DESCRIPTION
       STOP!

       Read the Reader's guide below if you are new to GNU parallel.

       GNU parallel is a shell tool for executing jobs in parallel using one
       or more computers. A job can be a single command or a small script that
       has to be run for each of the lines in the input. The typical input is
       a list of files, a list of hosts, a list of users, a list of URLs, or a
       list of tables. A job can also be a command that reads from a pipe. GNU
       parallel can then split the input into blocks and pipe a block into
       each command in parallel.

       If you use xargs and tee today you will find GNU parallel very easy to
       use as GNU parallel is written to have the same options as xargs. If
       you write loops in shell, you will find GNU parallel may be able to
       replace most of the loops and make them run faster by running several
       jobs in parallel.

       GNU parallel makes sure output from the commands is the same output as
       you would get had you run the commands sequentially. This makes it
       possible to use output from GNU parallel as input for other programs.

       For each line of input GNU parallel will execute command with the line
       as arguments. If no command is given, the line of input is executed.
       Several lines will be run in parallel. GNU parallel can often be used
       as a substitute for xargs or cat | bash.

   Reader's guide
       GNU parallel includes the 4 types of documentation: Tutorial, how-to,
       reference and explanation.

       Tutorial

       If you prefer reading a book buy GNU Parallel 2018 at
       https://www.lulu.com/shop/ole-tange/gnu-parallel-2018/paperback/product-23558902.html
       or download it at: https://doi.org/10.5281/zenodo.1146014 Read at least
       chapter 1+2. It should take you less than 20 minutes.

       Otherwise start by watching the intro videos for a quick introduction:
       https://youtube.com/playlist?list=PL284C9FF2488BC6D1

       If you want to dive deeper: spend a couple of hours walking through the
       tutorial (man parallel_tutorial). Your command line will love you for
       it.

       How-to

       You can find a lot of EXAMPLEs of use after the list of OPTIONS in man
       parallel (Use LESS=+/EXAMPLE: man parallel). That will give you an idea
       of what GNU parallel is capable of, and you may find a solution you can
       simply adapt to your situation.

       Reference

       If you need a one page printable cheat sheet you can find it on:
       https://www.gnu.org/software/parallel/parallel_cheat.pdf

       The man page is the reference for all options.

       Design discussion

       If you want to know the design decisions behind GNU parallel, try: man
       parallel_design. This is also a good intro if you intend to change GNU
       parallel.

OPTIONS
       command
           Command to execute.  If command or the following arguments contain
           replacement strings (such as {}) every instance will be substituted
           with the input.

           If command is given, GNU parallel solve the same tasks as xargs. If
           command is not given GNU parallel will behave similar to cat | sh.

           The command must be an executable, a script, a composed command, an
           alias, or a function.

           Bash functions: export -f the function first or use env_parallel.

           Bash, Csh, or Tcsh aliases: Use env_parallel.

           Zsh, Fish, Ksh, and Pdksh functions and aliases: Use env_parallel.

       {}  Input line. This replacement string will be replaced by a full line
           read from the input source. The input source is normally stdin
           (standard input), but can also be given with -a, :::, or ::::.

           The replacement string {} can be changed with -I.

           If the command line contains no replacement strings then {} will be
           appended to the command line.

           Replacement strings are normally quoted, so special characters are
           not parsed by the shell. The exception is if the command starts
           with a replacement string; then the string is not quoted.

       {.} Input line without extension. This replacement string will be
           replaced by the input with the extension removed. If the input line
           contains . after the last /, the last . until the end of the string
           will be removed and {.} will be replaced with the remaining. E.g.
           foo.jpg becomes foo, subdir/foo.jpg becomes subdir/foo,
           sub.dir/foo.jpg becomes sub.dir/foo, sub.dir/bar remains
           sub.dir/bar. If the input line does not contain . it will remain
           unchanged.

           The replacement string {.} can be changed with --er.

           To understand replacement strings see {}.

       {/} Basename of input line. This replacement string will be replaced by
           the input with the directory part removed.

           The replacement string {/} can be changed with --basenamereplace.

           To understand replacement strings see {}.

       {//}
           Dirname of input line. This replacement string will be replaced by
           the dir of the input line. See dirname(1).

           The replacement string {//} can be changed with --dirnamereplace.

           To understand replacement strings see {}.

       {/.}
           Basename of input line without extension. This replacement string
           will be replaced by the input with the directory and extension part
           removed. It is a combination of {/} and {.}.

           The replacement string {/.} can be changed with
           --basenameextensionreplace.

           To understand replacement strings see {}.

       {#} Sequence number of the job to run. This replacement string will be
           replaced by the sequence number of the job being run. It contains
           the same number as $PARALLEL_SEQ.

           The replacement string {#} can be changed with --seqreplace.

           To understand replacement strings see {}.

       {%} Job slot number. This replacement string will be replaced by the
           job's slot number between 1 and number of jobs to run in parallel.
           There will never be 2 jobs running at the same time with the same
           job slot number.

           The replacement string {%} can be changed with --slotreplace.

           If the job needs to be retried (e.g using --retries or
           --retry-failed) the job slot is not automatically updated. You
           should then instead use $PARALLEL_JOBSLOT:

             $ do_test() {
                 id="$3 {%}=$1 PARALLEL_JOBSLOT=$2"
                 echo run "$id";
                 sleep 1
                 # fail if {%} is odd
                 return `echo $1%2 | bc`
               }
             $ export -f do_test
             $ parallel -j3 --jl mylog do_test {%} \$PARALLEL_JOBSLOT {} ::: A B C D
             run A {%}=1 PARALLEL_JOBSLOT=1
             run B {%}=2 PARALLEL_JOBSLOT=2
             run C {%}=3 PARALLEL_JOBSLOT=3
             run D {%}=1 PARALLEL_JOBSLOT=1
             $ parallel --retry-failed -j3 --jl mylog do_test {%} \$PARALLEL_JOBSLOT {} ::: A B C D
             run A {%}=1 PARALLEL_JOBSLOT=1
             run C {%}=3 PARALLEL_JOBSLOT=2
             run D {%}=1 PARALLEL_JOBSLOT=3

           Notice how {%} and $PARALLEL_JOBSLOT differ in the retry run of C
           and D.

           To understand replacement strings see {}.

       {n} Argument from input source n or the n'th argument. This positional
           replacement string will be replaced by the input from input source
           n (when used with -a or ::::) or with the n'th argument (when used
           with -N). If n is negative it refers to the n'th last argument.

           To understand replacement strings see {}.

       {n.}
           Argument from input source n or the n'th argument without
           extension. It is a combination of {n} and {.}.

           This positional replacement string will be replaced by the input
           from input source n (when used with -a or ::::) or with the n'th
           argument (when used with -N). The input will have the extension
           removed.

           To understand positional replacement strings see {n}.

       {n/}
           Basename of argument from input source n or the n'th argument.  It
           is a combination of {n} and {/}.

           This positional replacement string will be replaced by the input
           from input source n (when used with -a or ::::) or with the n'th
           argument (when used with -N). The input will have the directory (if
           any) removed.

           To understand positional replacement strings see {n}.

       {n//}
           Dirname of argument from input source n or the n'th argument.  It
           is a combination of {n} and {//}.

           This positional replacement string will be replaced by the dir of
           the input from input source n (when used with -a or ::::) or with
           the n'th argument (when used with -N). See dirname(1).

           To understand positional replacement strings see {n}.

       {n/.}
           Basename of argument from input source n or the n'th argument
           without extension.  It is a combination of {n}, {/}, and {.}.

           This positional replacement string will be replaced by the input
           from input source n (when used with -a or ::::) or with the n'th
           argument (when used with -N). The input will have the directory (if
           any) and extension removed.

           To understand positional replacement strings see {n}.

       {=perl expression=}
           Replace with calculated perl expression. $_ will contain the same
           as {}. After evaluating perl expression $_ will be used as the
           value. It is recommended to only change $_ but you have full access
           to all of GNU parallel's internal functions and data structures.

           The expression must give the same result if evaluated twice -
           otherwise the behaviour is undefined. E.g. this will not work as
           expected:

               parallel echo '{= $_= ++$wrong_counter =}' ::: a b c

           A few convenience functions and data structures have been made:

            Q(string)     shell quote a string

            pQ(string)    perl quote a string

            uq() (or uq)  do not quote current replacement string

            hash(val)     compute B::hash(val)

            total_jobs()  number of jobs in total

            slot()        slot number of job

            seq()         sequence number of job

            @arg          the arguments

            skip()        skip this job (see also --filter)

            yyyy_mm_dd_hh_mm_ss()
            yyyy_mm_dd_hh_mm()
            yyyy_mm_dd()
            yyyymmddhhmmss()
            yyyymmddhhmm()
            yyyymmdd()    time functions

           Example:

             seq 10 | parallel echo {} + 1 is {= '$_++' =}
             parallel csh -c {= '$_="mkdir ".Q($_)' =} ::: '12" dir'
             seq 50 | parallel echo job {#} of {= '$_=total_jobs()' =}

           See also: --rpl --parens

       {=n perl expression=}
           Positional equivalent to {=perl expression=}. To understand
           positional replacement strings see {n}.

           See also: {=perl expression=} {n}.

       ::: arguments
           Use arguments from the command line as input source instead of
           stdin (standard input). Unlike other options for GNU parallel :::
           is placed after the command and before the arguments.

           The following are equivalent:

             (echo file1; echo file2) | parallel gzip
             parallel gzip ::: file1 file2
             parallel gzip {} ::: file1 file2
             parallel --arg-sep ,, gzip {} ,, file1 file2
             parallel --arg-sep ,, gzip ,, file1 file2
             parallel ::: "gzip file1" "gzip file2"

           To avoid treating ::: as special use --arg-sep to set the argument
           separator to something else. See also --arg-sep.

           If multiple ::: are given, each group will be treated as an input
           source, and all combinations of input sources will be generated.
           E.g. ::: 1 2 ::: a b c will result in the combinations (1,a) (1,b)
           (1,c) (2,a) (2,b) (2,c). This is useful for replacing nested for-
           loops.

           ::: and :::: can be mixed. So these are equivalent:

             parallel echo {1} {2} {3} ::: 6 7 ::: 4 5 ::: 1 2 3
             parallel echo {1} {2} {3} :::: <(seq 6 7) <(seq 4 5) \
               :::: <(seq 1 3)
             parallel -a <(seq 6 7) echo {1} {2} {3} :::: <(seq 4 5) \
               :::: <(seq 1 3)
             parallel -a <(seq 6 7) -a <(seq 4 5) echo {1} {2} {3} \
               ::: 1 2 3
             seq 6 7 | parallel -a - -a <(seq 4 5) echo {1} {2} {3} \
               ::: 1 2 3
             seq 4 5 | parallel echo {1} {2} {3} :::: <(seq 6 7) - \
               ::: 1 2 3

       :::+ arguments
           Like ::: but linked like --link to the previous input source.

           Contrary to --link, values do not wrap: The shortest input source
           determines the length.

           Example:

             parallel echo ::: a b c :::+ 1 2 3 ::: X Y :::+ 11 22

       :::: argfiles
           Another way to write -a argfile1 -a argfile2 ...

           ::: and :::: can be mixed.

           See -a, ::: and --link.

       ::::+ argfiles
           Like :::: but linked like --link to the previous input source.

           Contrary to --link, values do not wrap: The shortest input source
           determines the length.

       --null
       -0  Use NUL as delimiter.  Normally input lines will end in \n
           (newline). If they end in \0 (NUL), then use this option. It is
           useful for processing arguments that may contain \n (newline).

       --arg-file input-file
       -a input-file
           Use input-file as input source. If you use this option, stdin
           (standard input) is given to the first process run.  Otherwise,
           stdin (standard input) is redirected from /dev/null.

           If multiple -a are given, each input-file will be treated as an
           input source, and all combinations of input sources will be
           generated. E.g. The file foo contains 1 2, the file bar contains a
           b c.  -a foo -a bar will result in the combinations (1,a) (1,b)
           (1,c) (2,a) (2,b) (2,c). This is useful for replacing nested for-
           loops.

           See also: --link and {n}.

       --arg-file-sep sep-str
           Use sep-str instead of :::: as separator string between command and
           argument files. Useful if :::: is used for something else by the
           command.

           See also: ::::.

       --arg-sep sep-str
           Use sep-str instead of ::: as separator string. Useful if ::: is
           used for something else by the command.

           Also useful if you command uses ::: but you still want to read
           arguments from stdin (standard input): Simply change --arg-sep to a
           string that is not in the command line.

           See also: :::.

       --bar
           Show progress as a progress bar. In the bar is shown: % of jobs
           completed, estimated seconds left, and number of jobs started.

           It is compatible with zenity:

             seq 1000 | parallel -j30 --bar '(echo {};sleep 0.1)' \
               2> >(perl -pe 'BEGIN{$/="\r";$|=1};s/\r/\n/g' |
                    zenity --progress --auto-kill) | wc

       --basefile file
       --bf file
           file will be transferred to each sshlogin before a job is started.
           It will be removed if --cleanup is active. The file may be a script
           to run or some common base data needed for the job.  Multiple --bf
           can be specified to transfer more basefiles. The file will be
           transferred the same way as --transferfile.

       --basenamereplace replace-str
       --bnr replace-str
           Use the replacement string replace-str instead of {/} for basename
           of input line.

       --basenameextensionreplace replace-str
       --bner replace-str
           Use the replacement string replace-str instead of {/.} for basename
           of input line without extension.

       --bin binexpr
           Use binexpr as binning key and bin input to the jobs.

           binexpr is [column number|column name] [perlexpression] e.g. 3,
           Address, 3 $_%=100, Address s/\D//g.

           Each input line is split using --colsep. The value of the column is
           put into $_, the perl expression is executed, the resulting value
           is is the job slot that will be given the line. If the value is
           bigger than the number of jobslots the value will be modulo number
           of jobslots.

           This is similar to --shard but the hashing algorithm is a simple
           modulo, which makes it predictible which jobslot will receive which
           value.

           The performance is in the order of 100K rows per second. Faster if
           the bincol is small (<10), slower if it is big (>100).

           --bin requires --pipe and a fixed numeric value for --jobs.

           See also: --shard, --group-by, --roundrobin.

       --bg
           Run command in background thus GNU parallel will not wait for
           completion of the command before exiting. This is the default if
           --semaphore is set.

           See also: --fg, man sem.

           Implies --semaphore.

       --bibtex
       --citation
           Print the citation notice and BibTeX entry for GNU parallel,
           silence citation notice for all future runs, and exit. It will not
           run any commands.

           If it is impossible for you to run --citation you can instead use
           --will-cite, which will run commands, but which will only silence
           the citation notice for this single run.

           If you use --will-cite in scripts to be run by others you are
           making it harder for others to see the citation notice.  The
           development of GNU parallel is indirectly financed through
           citations, so if your users do not know they should cite then you
           are making it harder to finance development. However, if you pay
           10000 EUR, you have done your part to finance future development
           and should feel free to use --will-cite in scripts.

           If you do not want to help financing future development by letting
           other users see the citation notice or by paying, then please use
           another tool instead of GNU parallel. You can find some of the
           alternatives in man parallel_alternatives.

       --block size
       --block-size size
           Size of block in bytes to read at a time. The size can be postfixed
           with K, M, G, T, P, k, m, g, t, or p (see UNIT PREFIX).

           GNU parallel tries to meet the block size but can be off by the
           length of one record. For performance reasons size should be bigger
           than a two records. GNU parallel will warn you and automatically
           increase the size if you choose a size that is too small.

           If you use -N, --block-size should be bigger than N+1 records.

           size defaults to 1M.

           When using --pipepart a negative block size is not interpreted as a
           blocksize but as the number of blocks each jobslot should have. So
           this will run 10*5 = 50 jobs in total:

             parallel --pipepart -a myfile --block -10 -j5 wc

           This is an efficient alternative to --roundrobin because data is
           never read by GNU parallel, but you can still have very few
           jobslots process a large amount of data.

           See --pipe and --pipepart for use of this.

       --blocktimeout duration
       --bt duration
           Time out for reading block when using --pipe. If it takes longer
           than duration to read a full block, use the partial block read so
           far.

           duration must be in whole seconds, but can be expressed as floats
           postfixed with s, m, h, or d which would multiply the float by 1,
           60, 3600, or 86400. Thus these are equivalent: --blocktimeout
           100000 and --blocktimeout 1d3.5h16.6m4s.

       --cat
           Create a temporary file with content. Normally --pipe/--pipepart
           will give data to the program on stdin (standard input). With --cat
           GNU parallel will create a temporary file with the name in {}, so
           you can do: parallel --pipe --cat wc {}.

           Implies --pipe unless --pipepart is used.

           See also: --fifo.

       --cleanup
           Remove transferred files. --cleanup will remove the transferred
           files on the remote computer after processing is done.

             find log -name '*gz' | parallel \
               --sshlogin server.example.com --transferfile {} \
               --return {.}.bz2 --cleanup "zcat {} | bzip -9 >{.}.bz2"

           With --transferfile {} the file transferred to the remote computer
           will be removed on the remote computer. Directories on the remote
           computer containing the file will be removed if they are empty.

           With --return the file transferred from the remote computer will be
           removed on the remote computer. Directories on the remote computer
           containing the file will be removed if they are empty.

           --cleanup is ignored when not used with --transferfile or --return.

       --colsep regexp
       -C regexp
           Column separator. The input will be treated as a table with regexp
           separating the columns. The n'th column can be accessed using {n}
           or {n.}. E.g. {3} is the 3rd column.

           If there are more input sources, each input source will be
           separated, but the columns from each input source will be linked
           (see --link).

             parallel --colsep '-' echo {4} {3} {2} {1} \
               ::: A-B C-D ::: e-f g-h

           --colsep implies --trim rl, which can be overridden with --trim n.

           regexp is a Perl Regular Expression:
           https://perldoc.perl.org/perlre.html

       --compress
           Compress temporary files. If the output is big and very
           compressible this will take up less disk space in $TMPDIR and
           possibly be faster due to less disk I/O.

           GNU parallel will try pzstd, lbzip2, pbzip2, zstd, pigz, lz4, lzop,
           plzip, lzip, lrz, gzip, pxz, lzma, bzip2, xz, clzip, in that order,
           and use the first available.

       --compress-program prg
       --decompress-program prg
           Use prg for (de)compressing temporary files. It is assumed that prg
           -dc will decompress stdin (standard input) to stdout (standard
           output) unless --decompress-program is given.

       --csv
           Treat input as CSV-format. --colsep sets the field delimiter. It
           works very much like --colsep except it deals correctly with
           quoting:

              echo '"1 big, 2 small","2""x4"" plank",12.34' |
                parallel --csv echo {1} of {2} at {3}

           Even quoted newlines are parsed correctly:

              (echo '"Start of field 1 with newline'
               echo 'Line 2 in field 1";value 2') |
                parallel --csv --colsep ';' echo Field 1: {1} Field 2: {2}

           When used with --pipe only pass full CSV-records.

       --ctag str
           Color tag. See --tag.

       --ctagstring str
           Color tagstring. See --tagstring.

       --delay mytime
           Delay starting next job by mytime. GNU parallel will pause mytime
           after starting each job. mytime is normally in seconds, but can be
           floats postfixed with s, m, h, or d which would multiply the float
           by 1, 60, 3600, or 86400. Thus these are equivalent: --delay 100000
           and --delay 1d3.5h16.6m4s.

           If you append 'auto' to mytime (e.g. 13m3sauto) GNU parallel will
           automatically try to find the optimal value: If a job fails, mytime
           is doubled. If a job succeeds, mytime is decreased by 10%.

       --delimiter delim
       -d delim
           Input items are terminated by delim.  Quotes and backslash are not
           special; every character in the input is taken literally.  Disables
           the end-of-file string, which is treated like any other argument.
           The specified delimiter may be characters, C-style character
           escapes such as \n, or octal or hexadecimal escape codes.  Octal
           and hexadecimal escape codes are understood as for the printf
           command.  Multibyte characters are not supported.

       --dirnamereplace replace-str
       --dnr replace-str
           Use the replacement string replace-str instead of {//} for dirname
           of input line.

       --dry-run
           Print the job to run on stdout (standard output), but do not run
           the job. Use -v -v to include the wrapping that GNU parallel
           generates (for remote jobs, --tmux, --nice, --pipe, --pipepart,
           --fifo and --cat). Do not count on this literally, though, as the
           job may be scheduled on another computer or the local computer if :
           is in the list.

       -E eof-str
           Set the end of file string to eof-str.  If the end of file string
           occurs as a line of input, the rest of the input is not read.  If
           neither -E nor -e is used, no end of file string is used.

       --eof[=eof-str]
       -e[eof-str]
           This option is a synonym for the -E option.  Use -E instead,
           because it is POSIX compliant for xargs while this option is not.
           If eof-str is omitted, there is no end of file string.  If neither
           -E nor -e is used, no end of file string is used.

       --embed
           Embed GNU parallel in a shell script. If you need to distribute
           your script to someone who does not want to install GNU parallel
           you can embed GNU parallel in your own shell script:

             parallel --embed > new_script

           After which you add your code at the end of new_script. This is
           tested on ash, bash, dash, ksh, sh, and zsh.

       --env var
           Copy environment variable var. This will copy var to the
           environment that the command is run in. This is especially useful
           for remote execution.

           In Bash var can also be a Bash function - just remember to export
           -f the function, see command.

           The variable '_' is special. It will copy all exported environment
           variables except for the ones mentioned in
           ~/.parallel/ignored_vars.

           To copy the full environment (both exported and not exported
           variables, arrays, and functions) use env_parallel.

           See also: --record-env, --session.

       --eta
           Show the estimated number of seconds before finishing. This forces
           GNU parallel to read all jobs before starting to find the number of
           jobs. GNU parallel normally only reads the next job to run.

           The estimate is based on the runtime of finished jobs, so the first
           estimate will only be shown when the first job has finished.

           Implies --progress.

           See also: --bar, --progress.

       --fg
           Run command in foreground.

           With --tmux and --tmuxpane GNU parallel will start tmux in the
           foreground.

           With --semaphore GNU parallel will run the command in the
           foreground (opposite --bg), and wait for completion of the command
           before exiting.

           See also: --bg, man sem.

       --fifo
           Create a temporary fifo with content. Normally --pipe and
           --pipepart will give data to the program on stdin (standard input).
           With --fifo GNU parallel will create a temporary fifo with the name
           in {}, so you can do: parallel --pipe --fifo wc {}.

           Beware: If data is not read from the fifo, the job will block
           forever.

           Implies --pipe unless --pipepart is used.

           See also: --cat.

       --filter filter
           Only run jobs where filter is true. filter can contain replacement
           strings and Perl code. Example:

              parallel --filter '{1} < {2}+1' echo ::: {1..3} ::: {1..3}

           Outputs: 1,1 1,2 1,3 2,2 2,3 3,3

       --filter-hosts
           Remove down hosts. For each remote host: check that login through
           ssh works. If not: do not use this host.

           For performance reasons, this check is performed only at the start
           and every time --sshloginfile is changed. If an host goes down
           after the first check, it will go undetected until --sshloginfile
           is changed; --retries can be used to mitigate this.

           Currently you can not put --filter-hosts in a profile, $PARALLEL,
           /etc/parallel/config or similar. This is because GNU parallel uses
           GNU parallel to compute this, so you will get an infinite loop.
           This will likely be fixed in a later release.

       --gnu
           Behave like GNU parallel. This option historically took precedence
           over --tollef. The --tollef option is now retired, and therefore
           may not be used. --gnu is kept for compatibility.

       --group
           Group output. Output from each job is grouped together and is only
           printed when the command is finished. Stdout (standard output)
           first followed by stderr (standard error).

           This takes in the order of 0.5ms per job and depends on the speed
           of your disk for larger output. It can be disabled with -u, but
           this means output from different commands can get mixed.

           --group is the default. Can be reversed with -u.

           See also: --line-buffer --ungroup

       --group-by val
           Group input by value. Combined with --pipe/--pipepart --group-by
           groups lines with the same value into a record.

           The value can be computed from the full line or from a single
           column.

           val can be:

            column number Use the value in the column numbered.

            column name   Treat the first line as a header and use the value
                          in the column named.

                          (Not supported with --pipepart).

            perl expression
                          Run the perl expression and use $_ as the value.

            column number perl expression
                          Put the value of the column put in $_, run the perl
                          expression, and use $_ as the value.

            column name perl expression
                          Put the value of the column put in $_, run the perl
                          expression, and use $_ as the value.

                          (Not supported with --pipepart).

           Example:

             UserID, Consumption
             123,    1
             123,    2
             12-3,   1
             221,    3
             221,    1
             2/21,   5

           If you want to group 123, 12-3, 221, and 2/21 into 4 records and
           pass one record at a time to wc:

             tail -n +2 table.csv | \
               parallel --pipe --colsep , --group-by 1 -kN1 wc

           Make GNU parallel treat the first line as a header:

             cat table.csv | \
               parallel --pipe --colsep , --header : --group-by 1 -kN1 wc

           Address column by column name:

             cat table.csv | \
               parallel --pipe --colsep , --header : --group-by UserID -kN1 wc

           If 12-3 and 123 are really the same UserID, remove non-digits in
           UserID when grouping:

             cat table.csv | parallel --pipe --colsep , --header : \
               --group-by 'UserID s/\D//g' -kN1 wc

           See also: --shard, --roundrobin.

       --help
       -h  Print a summary of the options to GNU parallel and exit.

       --halt-on-error val
       --halt val
           When should GNU parallel terminate? In some situations it makes no
           sense to run all jobs. GNU parallel should simply give up as soon
           as a condition is met.

           val defaults to never, which runs all jobs no matter what.

           val can also take on the form of when,why.

           when can be 'now' which means kill all running jobs and halt
           immediately, or it can be 'soon' which means wait for all running
           jobs to complete, but start no new jobs.

           why can be 'fail=X', 'fail=Y%', 'success=X', 'success=Y%',
           'done=X', or 'done=Y%' where X is the number of jobs that has to
           fail, succeed, or be done before halting, and Y is the percentage
           of jobs that has to fail, succeed, or be done before halting.

           Example:

            --halt now,fail=1     exit when the first job fails. Kill running
                                  jobs.

            --halt soon,fail=3    exit when 3 jobs fail, but wait for running
                                  jobs to complete.

            --halt soon,fail=3%   exit when 3% of the jobs have failed, but
                                  wait for running jobs to complete.

            --halt now,success=1  exit when a job succeeds. Kill running jobs.

            --halt soon,success=3 exit when 3 jobs succeeds, but wait for
                                  running jobs to complete.

            --halt now,success=3% exit when 3% of the jobs have succeeded.
                                  Kill running jobs.

            --halt now,done=1     exit when one of the jobs finishes. Kill
                                  running jobs.

            --halt soon,done=3    exit when 3 jobs finishes, but wait for
                                  running jobs to complete.

            --halt now,done=3%    exit when 3% of the jobs have finished. Kill
                                  running jobs.

           For backwards compatibility these also work:

           0           never

           1           soon,fail=1

           2           now,fail=1

           -1          soon,success=1

           -2          now,success=1

           1-99%       soon,fail=1-99%

       --header regexp
           Use regexp as header. For normal usage the matched header
           (typically the first line: --header '.*\n') will be split using
           --colsep (which will default to '\t') and column names can be used
           as replacement variables: {column name}, {column name/}, {column
           name//}, {column name/.}, {column name.}, {=column name perl
           expression =}, ..

           For --pipe the matched header will be prepended to each output.

           --header : is an alias for --header '.*\n'.

           If regexp is a number, it is a fixed number of lines.

       --hostgroups
       --hgrp
           Enable hostgroups on arguments. If an argument contains '@' the
           string after '@' will be removed and treated as a list of
           hostgroups on which this job is allowed to run. If there is no
           --sshlogin with a corresponding group, the job will run on any
           hostgroup.

           Example:

             parallel --hostgroups \
               --sshlogin @grp1/myserver1 -S @grp1+grp2/myserver2 \
               --sshlogin @grp3/myserver3 \
               echo ::: my_grp1_arg@grp1 arg_for_grp2@grp2 third@grp1+grp3

           my_grp1_arg may be run on either myserver1 or myserver2, third may
           be run on either myserver1 or myserver3, but arg_for_grp2 will only
           be run on myserver2.

           See also: --sshlogin, $PARALLEL_HOSTGROUPS,
           $PARALLEL_ARGHOSTGROUPS.

       -I replace-str
           Use the replacement string replace-str instead of {}.

       --replace[=replace-str]
       -i[replace-str]
           This option is a synonym for -Ireplace-str if replace-str is
           specified, and for -I {} otherwise.  This option is deprecated; use
           -I instead.

       --joblog logfile
           Logfile for executed jobs. Save a list of the executed jobs to
           logfile in the following TAB separated format: sequence number,
           sshlogin, start time as seconds since epoch, run time in seconds,
           bytes in files transferred, bytes in files returned, exit status,
           signal, and command run.

           For --pipe bytes transferred and bytes returned are number of input
           and output of bytes.

           If logfile is prepended with '+' log lines will be appended to the
           logfile.

           To convert the times into ISO-8601 strict do:

             cat logfile | perl -a -F"\t" -ne \
               'chomp($F[2]=`date -d \@$F[2] +%FT%T`); print join("\t",@F)'

           If the host is long, you can use column -t to pretty print it:

             cat joblog | column -t

           See also: --resume --resume-failed.

       --jobs N
       -j N
       --max-procs N
       -P N
           Number of jobslots on each machine. Run up to N jobs in parallel.
           0 means as many as possible (this can take a while to determine).
           Default is 100% which will run one job per CPU on each machine.

           Due to a bug -j 0 will also evaluate replacement strings twice up
           to the number of joblots:

             # This will not count from 1 but from number-of-jobslots
             seq 10000 | parallel -j0   echo '{= $_ = $foo++; =}' | head
             # This will count from 1
             seq 10000 | parallel -j100 echo '{= $_ = $foo++; =}' | head

           If --semaphore is set, the default is 1 thus making a mutex.

       --jobs +N
       -j +N
       --max-procs +N
       -P +N
           Add N to the number of CPUs.  Run this many jobs in parallel.  See
           also --use-cores-instead-of-threads and
           --use-sockets-instead-of-threads.

       --jobs -N
       -j -N
       --max-procs -N
       -P -N
           Subtract N from the number of CPUs.  Run this many jobs in
           parallel.  If the evaluated number is less than 1 then 1 will be
           used.  See also --use-cores-instead-of-threads and
           --use-sockets-instead-of-threads.

       --jobs N%
       -j N%
       --max-procs N%
       -P N%
           Multiply N% with the number of CPUs.  Run this many jobs in
           parallel. See also --use-cores-instead-of-threads and
           --use-sockets-instead-of-threads.

       --jobs procfile
       -j procfile
       --max-procs procfile
       -P procfile
           Read parameter from file. Use the content of procfile as parameter
           for -j. E.g. procfile could contain the string 100% or +2 or 10. If
           procfile is changed when a job completes, procfile is read again
           and the new number of jobs is computed. If the number is lower than
           before, running jobs will be allowed to finish but new jobs will
           not be started until the wanted number of jobs has been reached.
           This makes it possible to change the number of simultaneous running
           jobs while GNU parallel is running.

       --keep-order
       -k  Keep sequence of output same as the order of input. Normally the
           output of a job will be printed as soon as the job completes. Try
           this to see the difference:

             parallel -j4 sleep {}\; echo {} ::: 2 1 4 3
             parallel -j4 -k sleep {}\; echo {} ::: 2 1 4 3

           If used with --onall or --nonall the output will grouped by
           sshlogin in sorted order.

           If used with --pipe --roundrobin and the same input, the jobslots
           will get the same blocks in the same order in every run.

           -k only affects the order in which the output is printed - not the
           order in which jobs are run.

       -L recsize
           When used with --pipe: Read records of recsize.

           When used otherwise: Use at most recsize nonblank input lines per
           command line.  Trailing blanks cause an input line to be logically
           continued on the next input line.

           -L 0 means read one line, but insert 0 arguments on the command
           line.

           recsize can be postfixed with K, M, G, T, P, k, m, g, t, or p (see
           UNIT PREFIX).

           Implies -X unless -m, --xargs, or --pipe is set.

       --max-lines[=recsize]
       -l[recsize]
           When used with --pipe: Read records of recsize lines.

           When used otherwise: Synonym for the -L option.  Unlike -L, the
           recsize argument is optional.  If recsize is not specified, it
           defaults to one.  The -l option is deprecated since the POSIX
           standard specifies -L instead.

           -l 0 is an alias for -l 1.

           Implies -X unless -m, --xargs, or --pipe is set.

       --limit "command args"
           Dynamic job limit. Before starting a new job run command with args.
           The exit value of command determines what GNU parallel will do:

           0   Below limit. Start another job.

           1   Over limit. Start no jobs.

           2   Way over limit. Kill the youngest job.

           You can use any shell command. There are 3 predefined commands:

           "io n"    Limit for I/O. The amount of disk I/O will be computed as
                     a value 0-100, where 0 is no I/O and 100 is at least one
                     disk is 100% saturated.

           "load n"  Similar to --load.

           "mem n"   Similar to --memfree.

       --line-buffer
       --lb
           Buffer output on line basis. --group will keep the output together
           for a whole job. --ungroup allows output to mixup with half a line
           coming from one job and half a line coming from another job.
           --line-buffer fits between these two: GNU parallel will print a
           full line, but will allow for mixing lines of different jobs.

           --line-buffer takes more CPU power than both --group and --ungroup,
           but can be much faster than --group if the CPU is not the limiting
           factor.

           Normally --line-buffer does not buffer on disk, and can thus
           process an infinite amount of data, but it will buffer on disk when
           combined with: --keep-order, --results, --compress, and --files.
           This will make it as slow as --group and will limit output to the
           available disk space.

           With --keep-order --line-buffer will output lines from the first
           job continuously while it is running, then lines from the second
           job while that is running. It will buffer full lines, but jobs will
           not mix. Compare:

             parallel -j0 'echo {};sleep {};echo {}' ::: 1 3 2 4
             parallel -j0 --lb 'echo {};sleep {};echo {}' ::: 1 3 2 4
             parallel -j0 -k --lb 'echo {};sleep {};echo {}' ::: 1 3 2 4

           See also: --group --ungroup

       --xapply
       --link
           Link input sources. Read multiple input sources like xapply. If
           multiple input sources are given, one argument will be read from
           each of the input sources. The arguments can be accessed in the
           command as {1} .. {n}, so {1} will be a line from the first input
           source, and {6} will refer to the line with the same line number
           from the 6th input source.

           Compare these two:

             parallel echo {1} {2} ::: 1 2 3 ::: a b c
             parallel --link echo {1} {2} ::: 1 2 3 ::: a b c

           Arguments will be recycled if one input source has more arguments
           than the others:

             parallel --link echo {1} {2} {3} \
               ::: 1 2 ::: I II III ::: a b c d e f g

           See also --header, :::+, ::::+.

       --load max-load
           Do not start new jobs on a given computer unless the number of
           running processes on the computer is less than max-load. max-load
           uses the same syntax as --jobs, so 100% for one per CPU is a valid
           setting. Only difference is 0 which is interpreted as 0.01.

       --controlmaster
       -M  Use ssh's ControlMaster to make ssh connections faster. Useful if
           jobs run remote and are very fast to run. This is disabled for
           sshlogins that specify their own ssh command.

       -m  Multiple arguments. Insert as many arguments as the command line
           length permits. If multiple jobs are being run in parallel:
           distribute the arguments evenly among the jobs. Use -j1 or --xargs
           to avoid this.

           If {} is not used the arguments will be appended to the line.  If
           {} is used multiple times each {} will be replaced with all the
           arguments.

           Support for -m with --sshlogin is limited and may fail.

           See also -X for context replace. If in doubt use -X as that will
           most likely do what is needed.

       --memfree size
           Minimum memory free when starting another job. The size can be
           postfixed with K, M, G, T, P, k, m, g, t, or p (see UNIT PREFIX).

           If the jobs take up very different amount of RAM, GNU parallel will
           only start as many as there is memory for. If less than size bytes
           are free, no more jobs will be started. If less than 50% size bytes
           are free, the youngest job will be killed, and put back on the
           queue to be run later.

           --retries must be set to determine how many times GNU parallel
           should retry a given job.

           See also: --memsuspend

       --memsuspend size
           Suspend jobs when there is less than 2 * size memory free. The size
           can be postfixed with K, M, G, T, P, k, m, g, t, or p (see UNIT
           PREFIX).

           If the available memory falls below 2 * size, GNU parallel will
           suspend some of the running jobs. If the available memory falls
           below size, only one job will be running.

           If a single job takes up at most size RAM, all jobs will complete
           without running out of memory. If you have swap available, you can
           usually lower size to around half the size of a single job - with
           the slight risk of swapping a little.

           Jobs will be resumed when more RAM is available - typically when
           the oldest job completes.

           --memsuspend only works on local jobs because there is no obvious
           way to suspend remote jobs.

           See also: --memfree

       --minversion version
           Print the version GNU parallel and exit.  If the current version of
           GNU parallel is less than version the exit code is 255. Otherwise
           it is 0.

           This is useful for scripts that depend on features only available
           from a certain version of GNU parallel.

       --max-args=max-args
       -n max-args
           Use at most max-args arguments per command line.  Fewer than max-
           args arguments will be used if the size (see the -s option) is
           exceeded, unless the -x option is given, in which case GNU parallel
           will exit.

           -n 0 means read one argument, but insert 0 arguments on the command
           line.

           max-args can be postfixed with K, M, G, T, P, k, m, g, t, or p (see
           UNIT PREFIX).

           Implies -X unless -m is set.

       --max-replace-args=max-args
       -N max-args
           Use at most max-args arguments per command line. Like -n but also
           makes replacement strings {1} .. {max-args} that represents
           argument 1 .. max-args. If too few args the {n} will be empty.

           -N 0 means read one argument, but insert 0 arguments on the command
           line.

           This will set the owner of the homedir to the user:

             tr ':' '\n' < /etc/passwd | parallel -N7 chown {1} {6}

           Implies -X unless -m or --pipe is set.

           max-args can be postfixed with K, M, G, T, P, k, m, g, t, or p (see
           UNIT PREFIX).

           When used with --pipe -N is the number of records to read. This is
           somewhat slower than --block.

       --nonall
           --onall with no arguments. Run the command on all computers given
           with --sshlogin but take no arguments. GNU parallel will log into
           --jobs number of computers in parallel and run the job on the
           computer. -j adjusts how many computers to log into in parallel.

           This is useful for running the same command (e.g. uptime) on a list
           of servers.

       --onall
           Run all the jobs on all computers given with --sshlogin. GNU
           parallel will log into --jobs number of computers in parallel and
           run one job at a time on the computer. The order of the jobs will
           not be changed, but some computers may finish before others.

           When using --group the output will be grouped by each server, so
           all the output from one server will be grouped together.

           --joblog will contain an entry for each job on each server, so
           there will be several job sequence 1.

       --output-as-files
       --outputasfiles
       --files
           Instead of printing the output to stdout (standard output) the
           output of each job is saved in a file and the filename is then
           printed.

           See also: --results

       --pipe
       --spreadstdin
           Spread input to jobs on stdin (standard input). Read a block of
           data from stdin (standard input) and give one block of data as
           input to one job.

           The block size is determined by --block. The strings --recstart and
           --recend tell GNU parallel how a record starts and/or ends. The
           block read will have the final partial record removed before the
           block is passed on to the job. The partial record will be prepended
           to next block.

           If --recstart is given this will be used to split at record start.

           If --recend is given this will be used to split at record end.

           If both --recstart and --recend are given both will have to match
           to find a split position.

           If neither --recstart nor --recend are given --recend defaults to
           '\n'. To have no record separator use --recend "".

           --files is often used with --pipe.

           --pipe maxes out at around 1 GB/s input, and 100 MB/s output. If
           performance is important use --pipepart.

           See also: --recstart, --recend, --fifo, --cat, --pipepart, --files.

       --pipepart
           Pipe parts of a physical file. --pipepart works similar to --pipe,
           but is much faster.

           --pipepart has a few limitations:

           o  The file must be a normal file or a block device (technically it
              must be seekable) and must be given using -a or ::::. The file
              cannot be a pipe, a fifo, or a stream as they are not seekable.

              If using a block device with lot of NUL bytes, remember to set
              --recend ''.

           o  Record counting (-N) and line counting (-L/-l) do not work.
              Instead use --recstart and --recend to determine where records
              end.

       --plain
           Ignore any --profile, $PARALLEL, and ~/.parallel/config to get full
           control on the command line (used by GNU parallel internally when
           called with --sshlogin).

       --plus
           Activate additional replacement strings: {+/} {+.} {+..} {+...}
           {..} {...} {/..} {/...} {##}. The idea being that '{+foo}' matches
           the opposite of '{foo}' and {} = {+/}/{/} = {.}.{+.} =
           {+/}/{/.}.{+.} = {..}.{+..} = {+/}/{/..}.{+..} = {...}.{+...} =
           {+/}/{/...}.{+...}

           {##} is the total number of jobs to be run. It is incompatible with
           -X/-m/--xargs.

           {0%} zero-padded jobslot.

           {0#} zero-padded sequence number.

           {choose_k} is inspired by n choose k: Given a list of n elements,
           choose k. k is the number of input sources and n is the number of
           arguments in an input source.  The content of the input sources
           must be the same and the arguments must be unique.

           Shorthands for variables:

             {slot}        $PARALLEL_JOBSLOT (see {%})
             {sshlogin}    $PARALLEL_SSHLOGIN
             {host}        $PARALLEL_SSHHOST
             {agrp}        $PARALLEL_ARGHOSTGROUPS
             {hgrp}        $PARALLEL_HOSTGROUPS

           The following dynamic replacement strings are also activated. They
           are inspired by bash's parameter expansion:

             {:-str}       str if the value is empty
             {:num}        remove the first num characters
             {:num1:num2}  characters from num1 to num2
             {#regexp}     remove prefix regexp (non-greedy)
             {##regexp}    remove prefix regexp (greedy)
             {%regexp}     remove postfix regexp (non-greedy)
             {%%regexp}    remove postfix regexp (greedy)
             {/regexp/str} replace regexp with str
             {^str}        uppercase str if found at the start
             {^^str}       uppercase str
             {,str}        lowercase str if found at the start
             {,,str}       lowercase str

       --progress
           Show progress of computations. List the computers involved in the
           task with number of CPUs detected and the max number of jobs to
           run. After that show progress for each computer: number of running
           jobs, number of completed jobs, and percentage of all jobs done by
           this computer. The percentage will only be available after all jobs
           have been scheduled as GNU parallel only read the next job when
           ready to schedule it - this is to avoid wasting time and memory by
           reading everything at startup.

           By sending GNU parallel SIGUSR2 you can toggle turning on/off
           --progress on a running GNU parallel process.

           See also: --eta and --bar.

       --max-line-length-allowed
           Print the maximal number of characters allowed on the command line
           and exit (used by GNU parallel itself to determine the line length
           on remote computers).

       --number-of-cpus (obsolete)
           Print the number of physical CPU cores and exit.

       --number-of-cores
           Print the number of physical CPU cores and exit (used by GNU
           parallel itself to determine the number of physical CPU cores on
           remote computers).

       --number-of-sockets
           Print the number of filled CPU sockets and exit (used by GNU
           parallel itself to determine the number of filled CPU sockets on
           remote computers).

       --number-of-threads
           Print the number of hyperthreaded CPU cores and exit (used by GNU
           parallel itself to determine the number of hyperthreaded CPU cores
           on remote computers).

       --no-keep-order
           Overrides an earlier --keep-order (e.g. if set in
           ~/.parallel/config).

       --nice niceness
           Run the command at this niceness.

           By default GNU parallel will run jobs at the same nice level as GNU
           parallel is started - both on the local machine and remote servers,
           so you are unlikely to ever use this option.

           Setting --nice will override this nice level. If the nice level is
           smaller than the current nice level, it will only affect remote
           jobs (e.g. if current level is 10 then --nice 5 will cause local
           jobs to be run at level 10, but remote jobs run at nice level 5).

       --interactive
       -p  Prompt the user about whether to run each command line and read a
           line from the terminal.  Only run the command line if the response
           starts with 'y' or 'Y'.  Implies -t.

       --parens parensstring
           Define start and end parenthesis for {= perl expression =}. The
           left and the right parenthesis can be multiple characters and are
           assumed to be the same length. The default is {==} giving {= as the
           start parenthesis and =} as the end parenthesis.

           Another useful setting is ,,,, which would make both parenthesis
           ,,:

             parallel --parens ,,,, echo foo is ,,s/I/O/g,, ::: FII

           See also: --rpl {= perl expression =}

       --profile profilename
       -J profilename
           Use profile profilename for options. This is useful if you want to
           have multiple profiles. You could have one profile for running jobs
           in parallel on the local computer and a different profile for
           running jobs on remote computers. See the section PROFILE FILES for
           examples.

           profilename corresponds to the file ~/.parallel/profilename.

           You can give multiple profiles by repeating --profile. If parts of
           the profiles conflict, the later ones will be used.

           Default: config

       --quote
       -q  Quote command. If your command contains special characters that
           should not be interpreted by the shell (e.g. ; \ | *), use --quote
           to escape these. The command must be a simple command (see man
           bash) without redirections and without variable assignments.

           See the section QUOTING. Most people will not need this.  Quoting
           is disabled by default.

       --no-run-if-empty
       -r  If the stdin (standard input) only contains whitespace, do not run
           the command.

           If used with --pipe this is slow.

       --noswap
           Do not start new jobs on a given computer if there is both swap-in
           and swap-out activity.

           The swap activity is only sampled every 10 seconds as the sampling
           takes 1 second to do.

           Swap activity is computed as (swap-in)*(swap-out) which in practice
           is a good value: swapping out is not a problem, swapping in is not
           a problem, but both swapping in and out usually indicates a
           problem.

           --memfree and --memsuspend may give better results, so try using
           those first.

       --record-env
           Record current environment variables in ~/.parallel/ignored_vars.
           This is useful before using --env _.

           See also: --env, --session.

       --recstart startstring
       --recend endstring
           If --recstart is given startstring will be used to split at record
           start.

           If --recend is given endstring will be used to split at record end.

           If both --recstart and --recend are given the combined string
           endstringstartstring will have to match to find a split position.
           This is useful if either startstring or endstring match in the
           middle of a record.

           If neither --recstart nor --recend are given then --recend defaults
           to '\n'. To have no record separator use --recend "".

           --recstart and --recend are used with --pipe.

           Use --regexp to interpret --recstart and --recend as regular
           expressions. This is slow, however.

       --regexp
           Use --regexp to interpret --recstart and --recend as regular
           expressions. This is slow, however.

       --remove-rec-sep
       --removerecsep
       --rrs
           Remove the text matched by --recstart and --recend before piping it
           to the command.

           Only used with --pipe.

       --results name
       --res name
           Save the output into files.

           Simple string output dir

           If name does not contain replacement strings and does not end in
           .csv/.tsv, the output will be stored in a directory tree rooted at
           name.  Within this directory tree, each command will result in
           three files: name/<ARGS>/stdout and name/<ARGS>/stderr,
           name/<ARGS>/seq, where <ARGS> is a sequence of directories
           representing the header of the input source (if using --header :)
           or the number of the input source and corresponding values.

           E.g:

             parallel --header : --results foo echo {a} {b} \
               ::: a I II ::: b III IIII

           will generate the files:

             foo/a/II/b/III/seq
             foo/a/II/b/III/stderr
             foo/a/II/b/III/stdout
             foo/a/II/b/IIII/seq
             foo/a/II/b/IIII/stderr
             foo/a/II/b/IIII/stdout
             foo/a/I/b/III/seq
             foo/a/I/b/III/stderr
             foo/a/I/b/III/stdout
             foo/a/I/b/IIII/seq
             foo/a/I/b/IIII/stderr
             foo/a/I/b/IIII/stdout

           and

             parallel --results foo echo {1} {2} ::: I II ::: III IIII

           will generate the files:

             foo/1/II/2/III/seq
             foo/1/II/2/III/stderr
             foo/1/II/2/III/stdout
             foo/1/II/2/IIII/seq
             foo/1/II/2/IIII/stderr
             foo/1/II/2/IIII/stdout
             foo/1/I/2/III/seq
             foo/1/I/2/III/stderr
             foo/1/I/2/III/stdout
             foo/1/I/2/IIII/seq
             foo/1/I/2/IIII/stderr
             foo/1/I/2/IIII/stdout

           CSV file output

           If name ends in .csv/.tsv the output will be a CSV-file named name.

           .csv gives a comma separated value file. .tsv gives a TAB separated
           value file.

           -.csv/-.tsv are special: It will give the file on stdout (standard
           output).

           JSON file output

           If name ends in .json the output will be a JSON-file named name.

           -.json is special: It will give the file on stdout (standard
           output).

           Replacement string output file

           If name contains a replacement string and the replaced result does
           not end in /, then the standard output will be stored in a file
           named by this result. Standard error will be stored in the same
           file name with '.err' added, and the sequence number will be stored
           in the same file name with '.seq' added.

           E.g.

             parallel --results my_{} echo ::: foo bar baz

           will generate the files:

             my_bar
             my_bar.err
             my_bar.seq
             my_baz
             my_baz.err
             my_baz.seq
             my_foo
             my_foo.err
             my_foo.seq

           Replacement string output dir

           If name contains a replacement string and the replaced result ends
           in /, then output files will be stored in the resulting dir.

           E.g.

             parallel --results my_{}/ echo ::: foo bar baz

           will generate the files:

             my_bar/seq
             my_bar/stderr
             my_bar/stdout
             my_baz/seq
             my_baz/stderr
             my_baz/stdout
             my_foo/seq
             my_foo/stderr
             my_foo/stdout

           See also: --files, --tag, --header, --joblog.

       --resume
           Resumes from the last unfinished job. By reading --joblog or the
           --results dir GNU parallel will figure out the last unfinished job
           and continue from there. As GNU parallel only looks at the sequence
           numbers in --joblog then the input, the command, and --joblog all
           have to remain unchanged; otherwise GNU parallel may run wrong
           commands.

           See also: --joblog, --results, --resume-failed, --retries.

       --resume-failed
           Retry all failed and resume from the last unfinished job. By
           reading --joblog GNU parallel will figure out the failed jobs and
           run those again. After that it will resume last unfinished job and
           continue from there. As GNU parallel only looks at the sequence
           numbers in --joblog then the input, the command, and --joblog all
           have to remain unchanged; otherwise GNU parallel may run wrong
           commands.

           See also: --joblog, --resume, --retry-failed, --retries.

       --retry-failed
           Retry all failed jobs in joblog. By reading --joblog GNU parallel
           will figure out the failed jobs and run those again.

           --retry-failed ignores the command and arguments on the command
           line: It only looks at the joblog.

           Differences between --resume, --resume-failed, --retry-failed

           In this example exit {= $_%=2 =} will cause every other job to
           fail.

             timeout -k 1 4 parallel --joblog log -j10 \
               'sleep {}; exit {= $_%=2 =}' ::: {10..1}

           4 jobs completed. 2 failed:

             Seq   [...]   Exitval Signal  Command
             10    [...]   1       0       sleep 1; exit 1
             9     [...]   0       0       sleep 2; exit 0
             8     [...]   1       0       sleep 3; exit 1
             7     [...]   0       0       sleep 4; exit 0

           --resume does not care about the Exitval, but only looks at Seq. If
           the Seq is run, it will not be run again. So if needed, you can
           change the command for the seqs not run yet:

             parallel --resume --joblog log -j10 \
               'sleep .{}; exit {= $_%=2 =}' ::: {10..1}

             Seq   [...]   Exitval Signal  Command
             [... as above ...]
             1     [...]   0       0       sleep .10; exit 0
             6     [...]   1       0       sleep .5; exit 1
             5     [...]   0       0       sleep .6; exit 0
             4     [...]   1       0       sleep .7; exit 1
             3     [...]   0       0       sleep .8; exit 0
             2     [...]   1       0       sleep .9; exit 1

           --resume-failed cares about the Exitval, but also only looks at Seq
           to figure out which commands to run. Again this means you can
           change the command, but not the arguments. It will run the failed
           seqs and the seqs not yet run:

             parallel --resume-failed --joblog log -j10 \
               'echo {};sleep .{}; exit {= $_%=3 =}' ::: {10..1}

             Seq   [...]   Exitval Signal  Command
             [... as above ...]
             10    [...]   1       0       echo 1;sleep .1; exit 1
             8     [...]   0       0       echo 3;sleep .3; exit 0
             6     [...]   2       0       echo 5;sleep .5; exit 2
             4     [...]   1       0       echo 7;sleep .7; exit 1
             2     [...]   0       0       echo 9;sleep .9; exit 0

           --retry-failed cares about the Exitval, but takes the command from
           the joblog. It ignores any arguments or commands given on the
           command line:

             parallel --retry-failed --joblog log -j10 this part is ignored

             Seq   [...]   Exitval Signal  Command
             [... as above ...]
             10    [...]   1       0       echo 1;sleep .1; exit 1
             6     [...]   2       0       echo 5;sleep .5; exit 2
             4     [...]   1       0       echo 7;sleep .7; exit 1

           See also: --joblog, --resume, --resume-failed, --retries.

       --retries n
           If a job fails, retry it on another computer on which it has not
           failed. Do this n times. If there are fewer than n computers in
           --sshlogin GNU parallel will re-use all the computers. This is
           useful if some jobs fail for no apparent reason (such as network
           failure).

       --return filename
           Transfer files from remote computers. --return is used with
           --sshlogin when the arguments are files on the remote computers.
           When processing is done the file filename will be transferred from
           the remote computer using rsync and will be put relative to the
           default login dir. E.g.

             echo foo/bar.txt | parallel --return {.}.out \
               --sshlogin server.example.com touch {.}.out

           This will transfer the file $HOME/foo/bar.out from the computer
           server.example.com to the file foo/bar.out after running touch
           foo/bar.out on server.example.com.

             parallel -S server --trc out/./{}.out touch {}.out ::: in/file

           This will transfer the file in/file.out from the computer
           server.example.com to the files out/in/file.out after running touch
           in/file.out on server.

             echo /tmp/foo/bar.txt | parallel --return {.}.out \
               --sshlogin server.example.com touch {.}.out

           This will transfer the file /tmp/foo/bar.out from the computer
           server.example.com to the file /tmp/foo/bar.out after running touch
           /tmp/foo/bar.out on server.example.com.

           Multiple files can be transferred by repeating the option multiple
           times:

             echo /tmp/foo/bar.txt | parallel \
               --sshlogin server.example.com \
               --return {.}.out --return {.}.out2 touch {.}.out {.}.out2

           --return is often used with --transferfile and --cleanup.

           --return is ignored when used with --sshlogin : or when not used
           with --sshlogin.

           For details on transferring see --transferfile.

       --round-robin
       --round
           Normally --pipe will give a single block to each instance of the
           command. With --roundrobin all blocks will at random be written to
           commands already running. This is useful if the command takes a
           long time to initialize.

           --keep-order will not work with --roundrobin as it is impossible to
           track which input block corresponds to which output.

           --roundrobin implies --pipe, except if --pipepart is given.

           See also: --group-by, --shard.

       --rpl 'tag perl expression'
           Use tag as a replacement string for perl expression. This makes it
           possible to define your own replacement strings. GNU parallel's 7
           replacement strings are implemented as:

             --rpl '{} '
             --rpl '{#} 1 $_=$job->seq()'
             --rpl '{%} 1 $_=$job->slot()'
             --rpl '{/} s:.*/::'
             --rpl '{//} $Global::use{"File::Basename"} ||=
               eval "use File::Basename; 1;"; $_ = dirname($_);'
             --rpl '{/.} s:.*/::; s:\.[^/.]+$::;'
             --rpl '{.} s:\.[^/.]+$::'

           The --plus replacement strings are implemented as:

             --rpl '{+/} s:/[^/]*$::'
             --rpl '{+.} s:.*\.::'
             --rpl '{+..} s:.*\.([^.]*\.):$1:'
             --rpl '{+...} s:.*\.([^.]*\.[^.]*\.):$1:'
             --rpl '{..} s:\.[^/.]+$::; s:\.[^/.]+$::'
             --rpl '{...} s:\.[^/.]+$::; s:\.[^/.]+$::; s:\.[^/.]+$::'
             --rpl '{/..} s:.*/::; s:\.[^/.]+$::; s:\.[^/.]+$::'
             --rpl '{/...} s:.*/::;s:\.[^/.]+$::;s:\.[^/.]+$::;s:\.[^/.]+$::'
             --rpl '{##} $_=total_jobs()'
             --rpl '{:-(.+?)} $_ ||= $$1'
             --rpl '{:(\d+?)} substr($_,0,$$1) = ""'
             --rpl '{:(\d+?):(\d+?)} $_ = substr($_,$$1,$$2);'
             --rpl '{#([^#].*?)} s/^$$1//;'
             --rpl '{%(.+?)} s/$$1$//;'
             --rpl '{/(.+?)/(.*?)} s/$$1/$$2/;'
             --rpl '{^(.+?)} s/^($$1)/uc($1)/e;'
             --rpl '{^^(.+?)} s/($$1)/uc($1)/eg;'
             --rpl '{,(.+?)} s/^($$1)/lc($1)/e;'
             --rpl '{,,(.+?)} s/($$1)/lc($1)/eg;'

           If the user defined replacement string starts with '{' it can also
           be used as a positional replacement string (like {2.}).

           It is recommended to only change $_ but you have full access to all
           of GNU parallel's internal functions and data structures.

           Here are a few examples:

             Is the job sequence even or odd?
             --rpl '{odd} $_ = seq() % 2 ? "odd" : "even"'
             Pad job sequence with leading zeros to get equal width
             --rpl '{0#} $f=1+int("".(log(total_jobs())/log(10)));
               $_=sprintf("%0${f}d",seq())'
             Job sequence counting from 0
             --rpl '{#0} $_ = seq() - 1'
             Job slot counting from 2
             --rpl '{%1} $_ = slot() + 1'
             Remove all extensions
             --rpl '{:} s:(\.[^/]+)*$::'

           You can have dynamic replacement strings by including parenthesis
           in the replacement string and adding a regular expression between
           the parenthesis. The matching string will be inserted as $$1:

             parallel --rpl '{%(.*?)} s/$$1//' echo {%.tar.gz} ::: my.tar.gz
             parallel --rpl '{:%(.+?)} s:$$1(\.[^/]+)*$::' \
               echo {:%_file} ::: my_file.tar.gz
             parallel -n3 --rpl '{/:%(.*?)} s:.*/(.*)$$1(\.[^/]+)*$:$1:' \
               echo job {#}: {2} {2.} {3/:%_1} ::: a/b.c c/d.e f/g_1.h.i

           You can even use multiple matches:

             parallel --rpl '{/(.+?)/(.*?)} s/$$1/$$2/;'
               echo {/replacethis/withthis} {/b/C} ::: a_replacethis_b

             parallel --rpl '{(.*?)/(.*?)} $_="$$2$_$$1"' \
               echo {swap/these} ::: -middle-

           See also: {= perl expression =} --parens

       --rsync-opts options
           Options to pass on to rsync. Setting --rsync-opts takes precedence
           over setting the environment variable $PARALLEL_RSYNC_OPTS.

       --max-chars=max-chars
       -s max-chars
           Use at most max-chars characters per command line, including the
           command and initial-arguments and the terminating nulls at the ends
           of the argument strings.  The largest allowed value is system-
           dependent, and is calculated as the argument length limit for exec,
           less the size of your environment.  The default value is the
           maximum.

           max-chars can be postfixed with K, M, G, T, P, k, m, g, t, or p
           (see UNIT PREFIX).

           Implies -X unless -m is set.

       --show-limits
           Display the limits on the command-line length which are imposed by
           the operating system and the -s option.  Pipe the input from
           /dev/null (and perhaps specify --no-run-if-empty) if you don't want
           GNU parallel to do anything.

       --semaphore
           Work as a counting semaphore. --semaphore will cause GNU parallel
           to start command in the background. When the number of jobs given
           by --jobs is reached, GNU parallel will wait for one of these to
           complete before starting another command.

           --semaphore implies --bg unless --fg is specified.

           --semaphore implies --semaphorename `tty` unless --semaphorename is
           specified.

           Used with --fg, --wait, and --semaphorename.

           The command sem is an alias for parallel --semaphore.

           See also: man sem.

       --semaphorename name
       --id name
           Use name as the name of the semaphore. Default is the name of the
           controlling tty (output from tty).

           The default normally works as expected when used interactively, but
           when used in a script name should be set. $$ or my_task_name are
           often a good value.

           The semaphore is stored in ~/.parallel/semaphores/

           Implies --semaphore.

           See also: man sem.

       --semaphoretimeout secs
       --st secs
           If secs > 0: If the semaphore is not released within secs seconds,
           take it anyway.

           If secs < 0: If the semaphore is not released within secs seconds,
           exit.

           Implies --semaphore.

           See also: man sem.

       --seqreplace replace-str
           Use the replacement string replace-str instead of {#} for job
           sequence number.

       --session
           Record names in current environment in $PARALLEL_IGNORED_NAMES and
           exit. Only used with env_parallel. Aliases, functions, and
           variables with names in $PARALLEL_IGNORED_NAMES will not be copied.

           Only supported in Ash, Bash, Dash, Ksh, Sh, and Zsh.

           See also: --env, --record-env.

       --shard shardexpr
           Use shardexpr as shard key and shard input to the jobs.

           shardexpr is [column number|column name] [perlexpression] e.g. 3,
           Address, 3 $_%=100, Address s/\d//g.

           Each input line is split using --colsep. The value of the column is
           put into $_, the perl expression is executed, the resulting value
           is hashed so that all lines of a given value is given to the same
           job slot.

           This is similar to sharding in databases.

           The performance is in the order of 100K rows per second. Faster if
           the shardcol is small (<10), slower if it is big (>100).

           --shard requires --pipe and a fixed numeric value for --jobs.

           See also: --bin, --group-by, --roundrobin.

       --shebang
       --hashbang
           GNU parallel can be called as a shebang (#!) command as the first
           line of a script. The content of the file will be treated as
           inputsource.

           Like this:

             #!/usr/bin/parallel --shebang -r wget

             https://ftpmirror.gnu.org/parallel/parallel-20120822.tar.bz2
             https://ftpmirror.gnu.org/parallel/parallel-20130822.tar.bz2
             https://ftpmirror.gnu.org/parallel/parallel-20140822.tar.bz2

           --shebang must be set as the first option.

           On FreeBSD env is needed:

             #!/usr/bin/env -S parallel --shebang -r wget

             https://ftpmirror.gnu.org/parallel/parallel-20120822.tar.bz2
             https://ftpmirror.gnu.org/parallel/parallel-20130822.tar.bz2
             https://ftpmirror.gnu.org/parallel/parallel-20140822.tar.bz2

           There are many limitations of shebang (#!) depending on your
           operating system. See details on
           https://www.in-ulm.de/~mascheck/various/shebang/

       --shebang-wrap
           GNU parallel can parallelize scripts by wrapping the shebang line.
           If the program can be run like this:

             cat arguments | parallel the_program

           then the script can be changed to:

             #!/usr/bin/parallel --shebang-wrap /original/parser --options

           E.g.

             #!/usr/bin/parallel --shebang-wrap /usr/bin/python

           If the program can be run like this:

             cat data | parallel --pipe the_program

           then the script can be changed to:

             #!/usr/bin/parallel --shebang-wrap --pipe /orig/parser --opts

           E.g.

             #!/usr/bin/parallel --shebang-wrap --pipe /usr/bin/perl -w

           --shebang-wrap must be set as the first option.

       --shellquote
           Does not run the command but quotes it. Useful for making quoted
           composed commands for GNU parallel.

           Multiple --shellquote with quote the string multiple times, so
           parallel --shellquote | parallel --shellquote can be written as
           parallel --shellquote --shellquote.

       --shuf
           Shuffle jobs. When having multiple input sources it is hard to
           randomize jobs. --shuf will generate all jobs, and shuffle them
           before running them. This is useful to get a quick preview of the
           results before running the full batch.

       --skip-first-line
           Do not use the first line of input (used by GNU parallel itself
           when called with --shebang).

       --sql DBURL (obsolete)
           Use --sqlmaster instead.

       --sqlmaster DBURL
           Submit jobs via SQL server. DBURL must point to a table, which will
           contain the same information as --joblog, the values from the input
           sources (stored in columns V1 .. Vn), and the output (stored in
           columns Stdout and Stderr).

           If DBURL is prepended with '+' GNU parallel assumes the table is
           already made with the correct columns and appends the jobs to it.

           If DBURL is not prepended with '+' the table will be dropped and
           created with the correct amount of V-columns unless

           --sqlmaster does not run any jobs, but it creates the values for
           the jobs to be run. One or more --sqlworker must be run to actually
           execute the jobs.

           If --wait is set, GNU parallel will wait for the jobs to complete.

           The format of a DBURL is:

             [sql:]vendor://[[user][:pwd]@][host][:port]/[db]/table

           E.g.

             sql:mysql://hr:hr@localhost:3306/hrdb/jobs
             mysql://scott:tiger@my.example.com/pardb/paralleljobs
             sql:oracle://scott:tiger@ora.example.com/xe/parjob
             postgresql://scott:tiger@pg.example.com/pgdb/parjob
             pg:///parjob
             sqlite3:///%2Ftmp%2Fpardb.sqlite/parjob
             csv:///%2Ftmp%2Fpardb/parjob

           Notice how / in the path of sqlite and CVS must be encoded as %2F.
           Except the last / in CSV which must be a /.

           It can also be an alias from ~/.sql/aliases:

             :myalias mysql:///mydb/paralleljobs

       --sqlandworker DBURL
           Shorthand for: --sqlmaster DBURL --sqlworker DBURL.

       --sqlworker DBURL
           Execute jobs via SQL server. Read the input sources variables from
           the table pointed to by DBURL. The command on the command line
           should be the same as given by --sqlmaster.

           If you have more than one --sqlworker jobs may be run more than
           once.

           If --sqlworker runs on the local machine, the hostname in the SQL
           table will not be ':' but instead the hostname of the machine.

       --ssh sshcommand
           GNU parallel defaults to using ssh for remote access. This can be
           overridden with --ssh. It can also be set on a per server basis
           (see --sshlogin).

       --sshdelay mytime
           Delay starting next ssh by mytime. GNU parallel will not start
           another ssh for the next mytime.

           For details on mytime see --delay.

       -S
       [@hostgroups/][ncpus/]sshlogin[,[@hostgroups/][ncpus/]sshlogin[,...]]
       -S @hostgroup
       --sshlogin
       [@hostgroups/][ncpus/]sshlogin[,[@hostgroups/][ncpus/]sshlogin[,...]]
       --sshlogin @hostgroup
           Distribute jobs to remote computers. The jobs will be run on a list
           of remote computers.

           If hostgroups is given, the sshlogin will be added to that
           hostgroup. Multiple hostgroups are separated by '+'. The sshlogin
           will always be added to a hostgroup named the same as sshlogin.

           If only the @hostgroup is given, only the sshlogins in that
           hostgroup will be used. Multiple @hostgroup can be given.

           GNU parallel will determine the number of CPUs on the remote
           computers and run the number of jobs as specified by -j.  If the
           number ncpus is given GNU parallel will use this number for number
           of CPUs on the host. Normally ncpus will not be needed.

           An sshlogin is of the form:

             [sshcommand [options]] [username@]hostname

           The sshlogin must not require a password (ssh-agent, ssh-copy-id,
           and sshpass may help with that).

           The sshlogin ':' is special, it means 'no ssh' and will therefore
           run on the local computer.

           The sshlogin '..' is special, it read sshlogins from
           ~/.parallel/sshloginfile or $XDG_CONFIG_HOME/parallel/sshloginfile

           The sshlogin '-' is special, too, it read sshlogins from stdin
           (standard input).

           To specify more sshlogins separate the sshlogins by comma, newline
           (in the same string), or repeat the options multiple times.

           For examples: see --sshloginfile.

           The remote host must have GNU parallel installed.

           --sshlogin is known to cause problems with -m and -X.

           --sshlogin is often used with --transferfile, --return, --cleanup,
           and --trc.

       --sshloginfile filename
       --slf filename
           File with sshlogins. The file consists of sshlogins on separate
           lines. Empty lines and lines starting with '#' are ignored.
           Example:

             server.example.com
             username@server2.example.com
             8/my-8-cpu-server.example.com
             2/my_other_username@my-dualcore.example.net
             # This server has SSH running on port 2222
             ssh -p 2222 server.example.net
             4/ssh -p 2222 quadserver.example.net
             # Use a different ssh program
             myssh -p 2222 -l myusername hexacpu.example.net
             # Use a different ssh program with default number of CPUs
             //usr/local/bin/myssh -p 2222 -l myusername hexacpu
             # Use a different ssh program with 6 CPUs
             6//usr/local/bin/myssh -p 2222 -l myusername hexacpu
             # Assume 16 CPUs on the local computer
             16/:
             # Put server1 in hostgroup1
             @hostgroup1/server1
             # Put myusername@server2 in hostgroup1+hostgroup2
             @hostgroup1+hostgroup2/myusername@server2
             # Force 4 CPUs and put 'ssh -p 2222 server3' in hostgroup1
             @hostgroup1/4/ssh -p 2222 server3

           When using a different ssh program the last argument must be the
           hostname.

           Multiple --sshloginfile are allowed.

           GNU parallel will first look for the file in current dir; if that
           fails it look for the file in ~/.parallel.

           The sshloginfile '..' is special, it read sshlogins from
           ~/.parallel/sshloginfile

           The sshloginfile '.' is special, it read sshlogins from
           /etc/parallel/sshloginfile

           The sshloginfile '-' is special, too, it read sshlogins from stdin
           (standard input).

           If the sshloginfile is changed it will be re-read when a job
           finishes though at most once per second. This makes it possible to
           add and remove hosts while running.

           This can be used to have a daemon that updates the sshloginfile to
           only contain servers that are up:

               cp original.slf tmp2.slf
               while [ 1 ] ; do
                 nice parallel --nonall -j0 -k --slf original.slf \
                   --tag echo | perl 's/\t$//' > tmp.slf
                 if diff tmp.slf tmp2.slf; then
                   mv tmp.slf tmp2.slf
                 fi
                 sleep 10
               done &
               parallel --slf tmp2.slf ...

       --slotreplace replace-str
           Use the replacement string replace-str instead of {%} for job slot
           number.

       --silent
           Silent.  The job to be run will not be printed. This is the
           default.  Can be reversed with -v.

       --template file=repl
       --tmpl file=repl
           Copy file to repl. All replacement strings in the contents of file
           will be replaced. All replacement strings in the name repl will be
           replaced.

           With --cleanup the new file will be removed when the job is done.

           If my.tmpl contains this:

             Xval: {x}
             Yval: {y}
             FixedValue: 9
             # x with 2 decimals
             DecimalX: {=x $_=sprintf("%.2f",$_) =}
             TenX: {=x $_=$_*10 =}
             RandomVal: {=1 $_=rand() =}

           it can be used like this:

             myprog() { echo Using "$@"; cat "$@"; }
             export -f myprog
             parallel --cleanup --header : --tmpl my.tmpl={#}.t myprog {#}.t \
               ::: x 1.234 2.345 3.45678 ::: y 1 2 3

       --tty
           Open terminal tty. If GNU parallel is used for starting a program
           that accesses the tty (such as an interactive program) then this
           option may be needed. It will default to starting only one job at a
           time (i.e. -j1), not buffer the output (i.e. -u), and it will open
           a tty for the job.

           You can of course override -j1 and -u.

           Using --tty unfortunately means that GNU parallel cannot kill the
           jobs (with --timeout, --memfree, or --halt). This is due to GNU
           parallel giving each child its own process group, which is then
           killed. Process groups are dependant on the tty.

       --tag
           Tag lines with arguments. Each output line will be prepended with
           the arguments and TAB (\t). When combined with --onall or --nonall
           the lines will be prepended with the sshlogin instead.

           --tag is ignored when using -u.

           --ctag gives the tag a color.

       --tagstring str
           Tag lines with a string. Each output line will be prepended with
           str and TAB (\t). str can contain replacement strings such as {}.

           --tagstring is ignored when using -u, --onall, and --nonall.

           --ctagstring gives the tag a color.

       --tee
           Pipe all data to all jobs. Used with --pipe/--pipepart and :::.

             seq 1000 | parallel --pipe --tee -v wc {} ::: -w -l -c

           How many numbers in 1..1000 contain 0..9, and how many bytes do
           they fill:

             seq 1000 | parallel --pipe --tee --tag \
               'grep {1} | wc {2}' ::: {0..9} ::: -l -c

           How many words contain a..z and how many bytes do they fill?

             parallel -a /usr/share/dict/words --pipepart --tee --tag \
               'grep {1} | wc {2}' ::: {a..z} ::: -l -c

       --termseq sequence
           Termination sequence. When a job is killed due to --timeout,
           --memfree, --halt, or abnormal termination of GNU parallel,
           sequence determines how the job is killed. The default is:

               TERM,200,TERM,100,TERM,50,KILL,25

           which sends a TERM signal, waits 200 ms, sends another TERM signal,
           waits 100 ms, sends another TERM signal, waits 50 ms, sends a KILL
           signal, waits 25 ms, and exits. GNU parallel detects if a process
           dies before the waiting time is up.

       --tmpdir dirname
           Directory for temporary files. GNU parallel normally buffers output
           into temporary files in /tmp. By setting --tmpdir you can use a
           different dir for the files. Setting --tmpdir is equivalent to
           setting $TMPDIR.

       --tmux (Long beta testing)
           Use tmux for output. Start a tmux session and run each job in a
           window in that session. No other output will be produced.

       --tmuxpane (Long beta testing)
           Use tmux for output but put output into panes in the first window.
           Useful if you want to monitor the progress of less than 100
           concurrent jobs.

       --timeout duration
           Time out for command. If the command runs for longer than duration
           seconds it will get killed as per --termseq.

           If duration is followed by a % then the timeout will dynamically be
           computed as a percentage of the median average runtime of
           successful jobs. Only values > 100% will make sense.

           duration is normally in seconds, but can be floats postfixed with
           s, m, h, or d which would multiply the float by 1, 60, 3600, or
           86400. Thus these are equivalent: --timeout 100000 and --timeout
           1d3.5h16.6m4s.

       --verbose
       -t  Print the job to be run on stderr (standard error).

           See also: -v, -p.

       --transfer
           Transfer files to remote computers. Shorthand for: --transferfile
           {}.

       --transferfile filename
       --tf filename
           --transferfile is used with --sshlogin to transfer files to the
           remote computers. The files will be transferred using rsync and
           will be put relative to the work dir (see --workdir).

           The filename will normally contain a replacement string.

           If the path contains /./ the remaining path will be relative to the
           work dir (for details: see rsync). If the work dir is /home/user,
           the transferring will be as follows:

             /tmp/foo/bar   => /tmp/foo/bar
             tmp/foo/bar    => /home/user/tmp/foo/bar
             /tmp/./foo/bar => /home/user/foo/bar
             tmp/./foo/bar  => /home/user/foo/bar

           Examples

           This will transfer the file foo/bar.txt to the computer
           server.example.com to the file $HOME/foo/bar.txt before running wc
           foo/bar.txt on server.example.com:

             echo foo/bar.txt | parallel --transferfile {} \
               --sshlogin server.example.com wc

           This will transfer the file /tmp/foo/bar.txt to the computer
           server.example.com to the file /tmp/foo/bar.txt before running wc
           /tmp/foo/bar.txt on server.example.com:

             echo /tmp/foo/bar.txt | parallel --transferfile {} \
               --sshlogin server.example.com wc

           This will transfer the file /tmp/foo/bar.txt to the computer
           server.example.com to the file foo/bar.txt before running wc
           ./foo/bar.txt on server.example.com:

             echo /tmp/./foo/bar.txt | parallel --transferfile {} \
               --sshlogin server.example.com wc {= s:.*/\./:./: =}

           --transferfile is often used with --return and --cleanup. A
           shorthand for --transferfile {} is --transfer.

           --transferfile is ignored when used with --sshlogin : or when not
           used with --sshlogin.

       --trc filename
           Transfer, Return, Cleanup. Shorthand for:

           --transferfile {} --return filename --cleanup

       --trim <n|l|r|lr|rl>
           Trim white space in input.

           n   No trim. Input is not modified. This is the default.

           l   Left trim. Remove white space from start of input. E.g. " a bc
               " -> "a bc ".

           r   Right trim. Remove white space from end of input. E.g. " a bc "
               -> " a bc".

           lr
           rl  Both trim. Remove white space from both start and end of input.
               E.g. " a bc " -> "a bc". This is the default if --colsep is
               used.

       --ungroup
       -u  Ungroup output.  Output is printed as soon as possible and bypasses
           GNU parallel internal processing. This may cause output from
           different commands to be mixed thus should only be used if you do
           not care about the output. Compare these:

             seq 4 | parallel -j0 \
               'sleep {};echo -n start{};sleep {};echo {}end'
             seq 4 | parallel -u -j0 \
               'sleep {};echo -n start{};sleep {};echo {}end'

           It also disables --tag. GNU parallel outputs faster with -u.
           Compare the speeds of these:

             parallel seq ::: 300000000 >/dev/null
             parallel -u seq ::: 300000000 >/dev/null
             parallel --line-buffer seq ::: 300000000 >/dev/null

           Can be reversed with --group.

           See also: --line-buffer --group

       --extensionreplace replace-str
       --er replace-str
           Use the replacement string replace-str instead of {.} for input
           line without extension.

       --use-sockets-instead-of-threads
       --use-cores-instead-of-threads
       --use-cpus-instead-of-cores (obsolete)
           Determine how GNU parallel counts the number of CPUs. GNU parallel
           uses this number when the number of jobslots is computed relative
           to the number of CPUs (e.g. 100% or +1).

           CPUs can be counted in three different ways:

           sockets The number of filled CPU sockets (i.e. the number of
                   physical chips).

           cores   The number of physical cores (i.e. the number of physical
                   compute cores).

           threads The number of hyperthreaded cores (i.e. the number of
                   virtual cores - with some of them possibly being
                   hyperthreaded)

           Normally the number of CPUs is computed as the number of CPU
           threads. With --use-sockets-instead-of-threads or
           --use-cores-instead-of-threads you can force it to be computed as
           the number of filled sockets or number of cores instead.

           Most users will not need these options.

           --use-cpus-instead-of-cores is a (misleading) alias for
           --use-sockets-instead-of-threads and is kept for backwards
           compatibility.

       -v  Verbose.  Print the job to be run on stdout (standard output). Can
           be reversed with --silent. See also -t.

           Use -v -v to print the wrapping ssh command when running remotely.

       --version
       -V  Print the version GNU parallel and exit.

       --workdir mydir
       --wd mydir
           Jobs will be run in the dir mydir. The default is the current dir
           for the local machine, and the login dir for remote computers.

           Files transferred using --transferfile and --return will be
           relative to mydir on remote computers.

           The special mydir value ... will create working dirs under
           ~/.parallel/tmp/. If --cleanup is given these dirs will be removed.

           The special mydir value . uses the current working dir.  If the
           current working dir is beneath your home dir, the value . is
           treated as the relative path to your home dir. This means that if
           your home dir is different on remote computers (e.g. if your login
           is different) the relative path will still be relative to your home
           dir.

           To see the difference try:

             parallel -S server pwd ::: ""
             parallel --wd . -S server pwd ::: ""
             parallel --wd ... -S server pwd ::: ""

           mydir can contain GNU parallel's replacement strings.

       --wait
           Wait for all commands to complete.

           Used with --semaphore or --sqlmaster.

           See also: man sem.

       -X  Multiple arguments with context replace. Insert as many arguments
           as the command line length permits. If multiple jobs are being run
           in parallel: distribute the arguments evenly among the jobs. Use
           -j1 to avoid this.

           If {} is not used the arguments will be appended to the line.  If
           {} is used as part of a word (like pic{}.jpg) then the whole word
           will be repeated. If {} is used multiple times each {} will be
           replaced with the arguments.

           Normally -X will do the right thing, whereas -m can give unexpected
           results if {} is used as part of a word.

           Support for -X with --sshlogin is limited and may fail.

           See also: -m.

       --exit
       -x  Exit if the size (see the -s option) is exceeded.

       --xargs
           Multiple arguments. Insert as many arguments as the command line
           length permits.

           If {} is not used the arguments will be appended to the line.  If
           {} is used multiple times each {} will be replaced with all the
           arguments.

           Support for --xargs with --sshlogin is limited and may fail.

           See also -X for context replace. If in doubt use -X as that will
           most likely do what is needed.

EXAMPLES
   EXAMPLE: Working as xargs -n1. Argument appending
       GNU parallel can work similar to xargs -n1.

       To compress all html files using gzip run:

         find . -name '*.html' | parallel gzip --best

       If the file names may contain a newline use -0. Substitute FOO BAR with
       FUBAR in all files in this dir and subdirs:

         find . -type f -print0 | \
           parallel -q0 perl -i -pe 's/FOO BAR/FUBAR/g'

       Note -q is needed because of the space in 'FOO BAR'.

   EXAMPLE: Simple network scanner
       prips can generate IP-addresses from CIDR notation. With GNU parallel
       you can build a simple network scanner to see which addresses respond
       to ping:

         prips 130.229.16.0/20 | \
           parallel --timeout 2 -j0 \
             'ping -c 1 {} >/dev/null && echo {}' 2>/dev/null

   EXAMPLE: Reading arguments from command line
       GNU parallel can take the arguments from command line instead of stdin
       (standard input). To compress all html files in the current dir using
       gzip run:

         parallel gzip --best ::: *.html

       To convert *.wav to *.mp3 using LAME running one process per CPU run:

         parallel lame {} -o {.}.mp3 ::: *.wav

   EXAMPLE: Inserting multiple arguments
       When moving a lot of files like this: mv *.log destdir you will
       sometimes get the error:

         bash: /bin/mv: Argument list too long

       because there are too many files. You can instead do:

         ls | grep -E '\.log$' | parallel mv {} destdir

       This will run mv for each file. It can be done faster if mv gets as
       many arguments that will fit on the line:

         ls | grep -E '\.log$' | parallel -m mv {} destdir

       In many shells you can also use printf:

         printf '%s\0' *.log | parallel -0 -m mv {} destdir

   EXAMPLE: Context replace
       To remove the files pict0000.jpg .. pict9999.jpg you could do:

         seq -w 0 9999 | parallel rm pict{}.jpg

       You could also do:

         seq -w 0 9999 | perl -pe 's/(.*)/pict$1.jpg/' | parallel -m rm

       The first will run rm 10000 times, while the last will only run rm as
       many times needed to keep the command line length short enough to avoid
       Argument list too long (it typically runs 1-2 times).

       You could also run:

         seq -w 0 9999 | parallel -X rm pict{}.jpg

       This will also only run rm as many times needed to keep the command
       line length short enough.

   EXAMPLE: Compute intensive jobs and substitution
       If ImageMagick is installed this will generate a thumbnail of a jpg
       file:

         convert -geometry 120 foo.jpg thumb_foo.jpg

       This will run with number-of-cpus jobs in parallel for all jpg files in
       a directory:

         ls *.jpg | parallel convert -geometry 120 {} thumb_{}

       To do it recursively use find:

         find . -name '*.jpg' | \
           parallel convert -geometry 120 {} {}_thumb.jpg

       Notice how the argument has to start with {} as {} will include path
       (e.g. running convert -geometry 120 ./foo/bar.jpg thumb_./foo/bar.jpg
       would clearly be wrong). The command will generate files like
       ./foo/bar.jpg_thumb.jpg.

       Use {.} to avoid the extra .jpg in the file name. This command will
       make files like ./foo/bar_thumb.jpg:

         find . -name '*.jpg' | \
           parallel convert -geometry 120 {} {.}_thumb.jpg

   EXAMPLE: Substitution and redirection
       This will generate an uncompressed version of .gz-files next to the
       .gz-file:

         parallel zcat {} ">"{.} ::: *.gz

       Quoting of > is necessary to postpone the redirection. Another solution
       is to quote the whole command:

         parallel "zcat {} >{.}" ::: *.gz

       Other special shell characters (such as * ; $ > < |  >> <<) also need
       to be put in quotes, as they may otherwise be interpreted by the shell
       and not given to GNU parallel.

   EXAMPLE: Composed commands
       A job can consist of several commands. This will print the number of
       files in each directory:

         ls | parallel 'echo -n {}" "; ls {}|wc -l'

       To put the output in a file called <name>.dir:

         ls | parallel '(echo -n {}" "; ls {}|wc -l) >{}.dir'

       Even small shell scripts can be run by GNU parallel:

         find . | parallel 'a={}; name=${a##*/};' \
           'upper=$(echo "$name" | tr "[:lower:]" "[:upper:]");'\
           'echo "$name - $upper"'

         ls | parallel 'mv {} "$(echo {} | tr "[:upper:]" "[:lower:]")"'

       Given a list of URLs, list all URLs that fail to download. Print the
       line number and the URL.

         cat urlfile | parallel "wget {} 2>/dev/null || grep -n {} urlfile"

       Create a mirror directory with the same filenames except all files and
       symlinks are empty files.

         cp -rs /the/source/dir mirror_dir
         find mirror_dir -type l | parallel -m rm {} '&&' touch {}

       Find the files in a list that do not exist

         cat file_list | parallel 'if [ ! -e {} ] ; then echo {}; fi'

   EXAMPLE: Composed command with perl replacement string
       You have a bunch of file. You want them sorted into dirs. The dir of
       each file should be named the first letter of the file name.

         parallel 'mkdir -p {=s/(.).*/$1/=}; mv {} {=s/(.).*/$1/=}' ::: *

   EXAMPLE: Composed command with multiple input sources
       You have a dir with files named as 24 hours in 5 minute intervals:
       00:00, 00:05, 00:10 .. 23:55. You want to find the files missing:

         parallel [ -f {1}:{2} ] "||" echo {1}:{2} does not exist \
           ::: {00..23} ::: {00..55..5}

   EXAMPLE: Calling Bash functions
       If the composed command is longer than a line, it becomes hard to read.
       In Bash you can use functions. Just remember to export -f the function.

         doit() {
           echo Doing it for $1
           sleep 2
           echo Done with $1
         }
         export -f doit
         parallel doit ::: 1 2 3

         doubleit() {
           echo Doing it for $1 $2
           sleep 2
           echo Done with $1 $2
         }
         export -f doubleit
         parallel doubleit ::: 1 2 3 ::: a b

       To do this on remote servers you need to transfer the function using
       --env:

         parallel --env doit -S server doit ::: 1 2 3
         parallel --env doubleit -S server doubleit ::: 1 2 3 ::: a b

       If your environment (aliases, variables, and functions) is small you
       can copy the full environment without having to export -f anything. See
       env_parallel.

   EXAMPLE: Function tester
       To test a program with different parameters:

         tester() {
           if (eval "$@") >&/dev/null; then
             perl -e 'printf "\033[30;102m[ OK ]\033[0m @ARGV\n"' "$@"
           else
             perl -e 'printf "\033[30;101m[FAIL]\033[0m @ARGV\n"' "$@"
           fi
         }
         export -f tester
         parallel tester my_program ::: arg1 arg2
         parallel tester exit ::: 1 0 2 0

       If my_program fails a red FAIL will be printed followed by the failing
       command; otherwise a green OK will be printed followed by the command.

   EXAMPLE: Continously show the latest line of output
       It can be useful to monitor the output of running jobs.

       This shows the most recent output line until a job finishes. After
       which the output of the job is printed in full:

         parallel '{} | tee >(cat >&3)' ::: 'command 1' 'command 2' \
           3> >(perl -ne '$|=1;chomp;printf"%.'$COLUMNS's\r",$_." "x100')

   EXAMPLE: Log rotate
       Log rotation renames a logfile to an extension with a higher number:
       log.1 becomes log.2, log.2 becomes log.3, and so on. The oldest log is
       removed. To avoid overwriting files the process starts backwards from
       the high number to the low number.  This will keep 10 old versions of
       the log:

         seq 9 -1 1 | parallel -j1 mv log.{} log.'{= $_++ =}'
         mv log log.1

   EXAMPLE: Removing file extension when processing files
       When processing files removing the file extension using {.} is often
       useful.

       Create a directory for each zip-file and unzip it in that dir:

         parallel 'mkdir {.}; cd {.}; unzip ../{}' ::: *.zip

       Recompress all .gz files in current directory using bzip2 running 1 job
       per CPU in parallel:

         parallel "zcat {} | bzip2 >{.}.bz2 && rm {}" ::: *.gz

       Convert all WAV files to MP3 using LAME:

         find sounddir -type f -name '*.wav' | parallel lame {} -o {.}.mp3

       Put all converted in the same directory:

         find sounddir -type f -name '*.wav' | \
           parallel lame {} -o mydir/{/.}.mp3

   EXAMPLE: Removing strings from the argument
       If you have directory with tar.gz files and want these extracted in the
       corresponding dir (e.g foo.tar.gz will be extracted in the dir foo) you
       can do:

         parallel --plus 'mkdir {..}; tar -C {..} -xf {}' ::: *.tar.gz

       If you want to remove a different ending, you can use {%string}:

         parallel --plus echo {%_demo} ::: mycode_demo keep_demo_here

       You can also remove a starting string with {#string}

         parallel --plus echo {#demo_} ::: demo_mycode keep_demo_here

       To remove a string anywhere you can use regular expressions with
       {/regexp/replacement} and leave the replacement empty:

         parallel --plus echo {/demo_/} ::: demo_mycode remove_demo_here

   EXAMPLE: Download 24 images for each of the past 30 days
       Let us assume a website stores images like:

         https://www.example.com/path/to/YYYYMMDD_##.jpg

       where YYYYMMDD is the date and ## is the number 01-24. This will
       download images for the past 30 days:

         getit() {
           date=$(date -d "today -$1 days" +%Y%m%d)
           num=$2
           echo wget https://www.example.com/path/to/${date}_${num}.jpg
         }
         export -f getit

         parallel getit ::: $(seq 30) ::: $(seq -w 24)

       $(date -d "today -$1 days" +%Y%m%d) will give the dates in YYYYMMDD
       with $1 days subtracted.

   EXAMPLE: Download world map from NASA
       NASA provides tiles to download on earthdata.nasa.gov. Download tiles
       for Blue Marble world map and create a 10240x20480 map.

         base=https://map1a.vis.earthdata.nasa.gov/wmts-geo/wmts.cgi
         service="SERVICE=WMTS&REQUEST=GetTile&VERSION=1.0.0"
         layer="LAYER=BlueMarble_ShadedRelief_Bathymetry"
         set="STYLE=&TILEMATRIXSET=EPSG4326_500m&TILEMATRIX=5"
         tile="TILEROW={1}&TILECOL={2}"
         format="FORMAT=image%2Fjpeg"
         url="$base?$service&$layer&$set&$tile&$format"

         parallel -j0 -q wget "$url" -O {1}_{2}.jpg ::: {0..19} ::: {0..39}
         parallel eval convert +append {}_{0..39}.jpg line{}.jpg ::: {0..19}
         convert -append line{0..19}.jpg world.jpg

   EXAMPLE: Download Apollo-11 images from NASA using jq
       Search NASA using their API to get JSON for images related to 'apollo
       11' and has 'moon landing' in the description.

       The search query returns JSON containing URLs to JSON containing
       collections of pictures. One of the pictures in each of these
       collection is large.

       wget is used to get the JSON for the search query. jq is then used to
       extract the URLs of the collections. parallel then calls wget to get
       each collection, which is passed to jq to extract the URLs of all
       images. grep filters out the large images, and parallel finally uses
       wget to fetch the images.

         base="https://images-api.nasa.gov/search"
         q="q=apollo 11"
         description="description=moon landing"
         media_type="media_type=image"
         wget -O - "$base?$q&$description&$media_type" |
           jq -r .collection.items[].href |
           parallel wget -O - |
           jq -r .[] |
           grep large |
           parallel wget

   EXAMPLE: Download video playlist in parallel
       youtube-dl is an excellent tool to download videos. It can, however,
       not download videos in parallel. This takes a playlist and downloads 10
       videos in parallel.

         url='youtu.be/watch?v=0wOf2Fgi3DE&list=UU_cznB5YZZmvAmeq7Y3EriQ'
         export url
         youtube-dl --flat-playlist "https://$url" |
           parallel --tagstring {#} --lb -j10 \
             youtube-dl --playlist-start {#} --playlist-end {#} '"https://$url"'

   EXAMPLE: Prepend last modified date (ISO8601) to file name
         parallel mv {} '{= $a=pQ($_); $b=$_;' \
           '$_=qx{date -r "$a" +%FT%T}; chomp; $_="$_ $b" =}' ::: *

       {= and =} mark a perl expression. pQ perl-quotes the string. date
       +%FT%T is the date in ISO8601 with time.

   EXAMPLE: Save output in ISO8601 dirs
       Save output from ps aux every second into dirs named
       yyyy-mm-ddThh:mm:ss+zz:zz.

         seq 1000 | parallel -N0 -j1 --delay 1 \
           --results '{= $_=`date -Isec`; chomp=}/' ps aux

   EXAMPLE: Digital clock with "blinking" :
       The : in a digital clock blinks. To make every other line have a ':'
       and the rest a ' ' a perl expression is used to look at the 3rd input
       source. If the value modulo 2 is 1: Use ":" otherwise use " ":

         parallel -k echo {1}'{=3 $_=$_%2?":":" "=}'{2}{3} \
           ::: {0..12} ::: {0..5} ::: {0..9}

   EXAMPLE: Aggregating content of files
       This:

         parallel --header : echo x{X}y{Y}z{Z} \> x{X}y{Y}z{Z} \
         ::: X {1..5} ::: Y {01..10} ::: Z {1..5}

       will generate the files x1y01z1 .. x5y10z5. If you want to aggregate
       the output grouping on x and z you can do this:

         parallel eval 'cat {=s/y01/y*/=} > {=s/y01//=}' ::: *y01*

       For all values of x and z it runs commands like:

         cat x1y*z1 > x1z1

       So you end up with x1z1 .. x5z5 each containing the content of all
       values of y.

   EXAMPLE: Breadth first parallel web crawler/mirrorer
       This script below will crawl and mirror a URL in parallel.  It
       downloads first pages that are 1 click down, then 2 clicks down, then
       3; instead of the normal depth first, where the first link link on each
       page is fetched first.

       Run like this:

         PARALLEL=-j100 ./parallel-crawl http://gatt.org.yeslab.org/

       Remove the wget part if you only want a web crawler.

       It works by fetching a page from a list of URLs and looking for links
       in that page that are within the same starting URL and that have not
       already been seen. These links are added to a new queue. When all the
       pages from the list is done, the new queue is moved to the list of URLs
       and the process is started over until no unseen links are found.

         #!/bin/bash

         # E.g. http://gatt.org.yeslab.org/
         URL=$1
         # Stay inside the start dir
         BASEURL=$(echo $URL | perl -pe 's:#.*::; s:(//.*/)[^/]*:$1:')
         URLLIST=$(mktemp urllist.XXXX)
         URLLIST2=$(mktemp urllist.XXXX)
         SEEN=$(mktemp seen.XXXX)

         # Spider to get the URLs
         echo $URL >$URLLIST
         cp $URLLIST $SEEN

         while [ -s $URLLIST ] ; do
           cat $URLLIST |
             parallel lynx -listonly -image_links -dump {} \; \
               wget -qm -l1 -Q1 {} \; echo Spidered: {} \>\&2 |
               perl -ne 's/#.*//; s/\s+\d+.\s(\S+)$/$1/ and
                 do { $seen{$1}++ or print }' |
             grep -F $BASEURL |
             grep -v -x -F -f $SEEN | tee -a $SEEN > $URLLIST2
           mv $URLLIST2 $URLLIST
         done

         rm -f $URLLIST $URLLIST2 $SEEN

   EXAMPLE: Process files from a tar file while unpacking
       If the files to be processed are in a tar file then unpacking one file
       and processing it immediately may be faster than first unpacking all
       files.

         tar xvf foo.tgz | perl -ne 'print $l;$l=$_;END{print $l}' | \
           parallel echo

       The Perl one-liner is needed to make sure the file is complete before
       handing it to GNU parallel.

   EXAMPLE: Rewriting a for-loop and a while-read-loop
       for-loops like this:

         (for x in `cat list` ; do
           do_something $x
         done) | process_output

       and while-read-loops like this:

         cat list | (while read x ; do
           do_something $x
         done) | process_output

       can be written like this:

         cat list | parallel do_something | process_output

       For example: Find which host name in a list has IP address 1.2.3 4:

         cat hosts.txt | parallel -P 100 host | grep 1.2.3.4

       If the processing requires more steps the for-loop like this:

         (for x in `cat list` ; do
           no_extension=${x%.*};
           do_step1 $x scale $no_extension.jpg
           do_step2 <$x $no_extension
         done) | process_output

       and while-loops like this:

         cat list | (while read x ; do
           no_extension=${x%.*};
           do_step1 $x scale $no_extension.jpg
           do_step2 <$x $no_extension
         done) | process_output

       can be written like this:

         cat list | parallel "do_step1 {} scale {.}.jpg ; do_step2 <{} {.}" |\
           process_output

       If the body of the loop is bigger, it improves readability to use a
       function:

         (for x in `cat list` ; do
           do_something $x
           [... 100 lines that do something with $x ...]
         done) | process_output

         cat list | (while read x ; do
           do_something $x
           [... 100 lines that do something with $x ...]
         done) | process_output

       can both be rewritten as:

         doit() {
           x=$1
           do_something $x
           [... 100 lines that do something with $x ...]
         }
         export -f doit
         cat list | parallel doit

   EXAMPLE: Rewriting nested for-loops
       Nested for-loops like this:

         (for x in `cat xlist` ; do
           for y in `cat ylist` ; do
             do_something $x $y
           done
         done) | process_output

       can be written like this:

         parallel do_something {1} {2} :::: xlist ylist | process_output

       Nested for-loops like this:

         (for colour in red green blue ; do
           for size in S M L XL XXL ; do
             echo $colour $size
           done
         done) | sort

       can be written like this:

         parallel echo {1} {2} ::: red green blue ::: S M L XL XXL | sort

   EXAMPLE: Finding the lowest difference between files
       diff is good for finding differences in text files. diff | wc -l gives
       an indication of the size of the difference. To find the differences
       between all files in the current dir do:

         parallel --tag 'diff {1} {2} | wc -l' ::: * ::: * | sort -nk3

       This way it is possible to see if some files are closer to other files.

   EXAMPLE: for-loops with column names
       When doing multiple nested for-loops it can be easier to keep track of
       the loop variable if is is named instead of just having a number. Use
       --header : to let the first argument be an named alias for the
       positional replacement string:

         parallel --header : echo {colour} {size} \
           ::: colour red green blue ::: size S M L XL XXL

       This also works if the input file is a file with columns:

         cat addressbook.tsv | \
           parallel --colsep '\t' --header : echo {Name} {E-mail address}

   EXAMPLE: All combinations in a list
       GNU parallel makes all combinations when given two lists.

       To make all combinations in a single list with unique values, you
       repeat the list and use replacement string {choose_k}:

         parallel --plus echo {choose_k} ::: A B C D ::: A B C D

         parallel --plus echo 2{2choose_k} 1{1choose_k} ::: A B C D ::: A B C D

       {choose_k} works for any number of input sources:

         parallel --plus echo {choose_k} ::: A B C D ::: A B C D ::: A B C D

   EXAMPLE: From a to b and b to c
       Assume you have input like:

         aardvark
         babble
         cab
         dab
         each

       and want to run combinations like:

         aardvark babble
         babble cab
         cab dab
         dab each

       If the input is in the file in.txt:

         parallel echo {1} - {2} ::::+ <(head -n -1 in.txt) <(tail -n +2 in.txt)

       If the input is in the array $a here are two solutions:

         seq $((${#a[@]}-1)) | \
           env_parallel --env a echo '${a[{=$_--=}]} - ${a[{}]}'
         parallel echo {1} - {2} ::: "${a[@]::${#a[@]}-1}" :::+ "${a[@]:1}"

   EXAMPLE: Count the differences between all files in a dir
       Using --results the results are saved in /tmp/diffcount*.

         parallel --results /tmp/diffcount "diff -U 0 {1} {2} | \
           tail -n +3 |grep -v '^@'|wc -l" ::: * ::: *

       To see the difference between file A and file B look at the file
       '/tmp/diffcount/1/A/2/B'.

   EXAMPLE: Speeding up fast jobs
       Starting a job on the local machine takes around 10 ms. This can be a
       big overhead if the job takes very few ms to run. Often you can group
       small jobs together using -X which will make the overhead less
       significant. Compare the speed of these:

         seq -w 0 9999 | parallel touch pict{}.jpg
         seq -w 0 9999 | parallel -X touch pict{}.jpg

       If your program cannot take multiple arguments, then you can use GNU
       parallel to spawn multiple GNU parallels:

         seq -w 0 9999999 | \
           parallel -j10 -q -I,, --pipe parallel -j0 touch pict{}.jpg

       If -j0 normally spawns 252 jobs, then the above will try to spawn 2520
       jobs. On a normal GNU/Linux system you can spawn 32000 jobs using this
       technique with no problems. To raise the 32000 jobs limit raise
       /proc/sys/kernel/pid_max to 4194303.

       If you do not need GNU parallel to have control over each job (so no
       need for --retries or --joblog or similar), then it can be even faster
       if you can generate the command lines and pipe those to a shell. So if
       you can do this:

         mygenerator | sh

       Then that can be parallelized like this:

         mygenerator | parallel --pipe --block 10M sh

       E.g.

         mygenerator() {
           seq 10000000 | perl -pe 'print "echo This is fast job number "';
         }
         mygenerator | parallel --pipe --block 10M sh

       The overhead is 100000 times smaller namely around 100 nanoseconds per
       job.

   EXAMPLE: Using shell variables
       When using shell variables you need to quote them correctly as they may
       otherwise be interpreted by the shell.

       Notice the difference between:

         ARR=("My brother's 12\" records are worth <\$\$\$>"'!' Foo Bar)
         parallel echo ::: ${ARR[@]} # This is probably not what you want

       and:

         ARR=("My brother's 12\" records are worth <\$\$\$>"'!' Foo Bar)
         parallel echo ::: "${ARR[@]}"

       When using variables in the actual command that contains special
       characters (e.g. space) you can quote them using '"$VAR"' or using "'s
       and -q:

         VAR="My brother's 12\" records are worth <\$\$\$>"
         parallel -q echo "$VAR" ::: '!'
         export VAR
         parallel echo '"$VAR"' ::: '!'

       If $VAR does not contain ' then "'$VAR'" will also work (and does not
       need export):

         VAR="My 12\" records are worth <\$\$\$>"
         parallel echo "'$VAR'" ::: '!'

       If you use them in a function you just quote as you normally would do:

         VAR="My brother's 12\" records are worth <\$\$\$>"
         export VAR
         myfunc() { echo "$VAR" "$1"; }
         export -f myfunc
         parallel myfunc ::: '!'

   EXAMPLE: Group output lines
       When running jobs that output data, you often do not want the output of
       multiple jobs to run together. GNU parallel defaults to grouping the
       output of each job, so the output is printed when the job finishes. If
       you want full lines to be printed while the job is running you can use
       --line-buffer. If you want output to be printed as soon as possible you
       can use -u.

       Compare the output of:

         parallel wget --limit-rate=100k \
           https://ftpmirror.gnu.org/parallel/parallel-20{}0822.tar.bz2 \
           ::: {12..16}
         parallel --line-buffer wget --limit-rate=100k \
           https://ftpmirror.gnu.org/parallel/parallel-20{}0822.tar.bz2 \
           ::: {12..16}
         parallel -u wget --limit-rate=100k \
           https://ftpmirror.gnu.org/parallel/parallel-20{}0822.tar.bz2 \
           ::: {12..16}

   EXAMPLE: Tag output lines
       GNU parallel groups the output lines, but it can be hard to see where
       the different jobs begin. --tag prepends the argument to make that more
       visible:

         parallel --tag wget --limit-rate=100k \
           https://ftpmirror.gnu.org/parallel/parallel-20{}0822.tar.bz2 \
           ::: {12..16}

       --tag works with --line-buffer but not with -u:

         parallel --tag --line-buffer wget --limit-rate=100k \
           https://ftpmirror.gnu.org/parallel/parallel-20{}0822.tar.bz2 \
           ::: {12..16}

       Check the uptime of the servers in ~/.parallel/sshloginfile:

         parallel --tag -S .. --nonall uptime

   EXAMPLE: Colorize output
       Give each job a new color. Most terminals support ANSI colors with the
       escape code "\033[30;3Xm" where 0 <= X <= 7:

           seq 10 | \
             parallel --tagstring '\033[30;3{=$_=++$::color%8=}m' seq {}
           parallel --rpl '{color} $_="\033[30;3".(++$::color%8)."m"' \
             --tagstring {color} seq {} ::: {1..10}

       To get rid of the initial \t (which comes from --tagstring):

           ... | perl -pe 's/\t//'

   EXAMPLE: Keep order of output same as order of input
       Normally the output of a job will be printed as soon as it completes.
       Sometimes you want the order of the output to remain the same as the
       order of the input. This is often important, if the output is used as
       input for another system. -k will make sure the order of output will be
       in the same order as input even if later jobs end before earlier jobs.

       Append a string to every line in a text file:

         cat textfile | parallel -k echo {} append_string

       If you remove -k some of the lines may come out in the wrong order.

       Another example is traceroute:

         parallel traceroute ::: qubes-os.org debian.org freenetproject.org

       will give traceroute of qubes-os.org, debian.org and
       freenetproject.org, but it will be sorted according to which job
       completed first.

       To keep the order the same as input run:

         parallel -k traceroute ::: qubes-os.org debian.org freenetproject.org

       This will make sure the traceroute to qubes-os.org will be printed
       first.

       A bit more complex example is downloading a huge file in chunks in
       parallel: Some internet connections will deliver more data if you
       download files in parallel. For downloading files in parallel see:
       "EXAMPLE: Download 10 images for each of the past 30 days". But if you
       are downloading a big file you can download the file in chunks in
       parallel.

       To download byte 10000000-19999999 you can use curl:

         curl -r 10000000-19999999 https://example.com/the/big/file >file.part

       To download a 1 GB file we need 100 10MB chunks downloaded and combined
       in the correct order.

         seq 0 99 | parallel -k curl -r \
           {}0000000-{}9999999 https://example.com/the/big/file > file

   EXAMPLE: Parallel grep
       grep -r greps recursively through directories. On multicore CPUs GNU
       parallel can often speed this up.

         find . -type f | parallel -k -j150% -n 1000 -m grep -H -n STRING {}

       This will run 1.5 job per CPU, and give 1000 arguments to grep.

   EXAMPLE: Grepping n lines for m regular expressions.
       The simplest solution to grep a big file for a lot of regexps is:

         grep -f regexps.txt bigfile

       Or if the regexps are fixed strings:

         grep -F -f regexps.txt bigfile

       There are 3 limiting factors: CPU, RAM, and disk I/O.

       RAM is easy to measure: If the grep process takes up most of your free
       memory (e.g. when running top), then RAM is a limiting factor.

       CPU is also easy to measure: If the grep takes >90% CPU in top, then
       the CPU is a limiting factor, and parallelization will speed this up.

       It is harder to see if disk I/O is the limiting factor, and depending
       on the disk system it may be faster or slower to parallelize. The only
       way to know for certain is to test and measure.

       Limiting factor: RAM

       The normal grep -f regexps.txt bigfile works no matter the size of
       bigfile, but if regexps.txt is so big it cannot fit into memory, then
       you need to split this.

       grep -F takes around 100 bytes of RAM and grep takes about 500 bytes of
       RAM per 1 byte of regexp. So if regexps.txt is 1% of your RAM, then it
       may be too big.

       If you can convert your regexps into fixed strings do that. E.g. if the
       lines you are looking for in bigfile all looks like:

         ID1 foo bar baz Identifier1 quux
         fubar ID2 foo bar baz Identifier2

       then your regexps.txt can be converted from:

         ID1.*Identifier1
         ID2.*Identifier2

       into:

         ID1 foo bar baz Identifier1
         ID2 foo bar baz Identifier2

       This way you can use grep -F which takes around 80% less memory and is
       much faster.

       If it still does not fit in memory you can do this:

         parallel --pipepart -a regexps.txt --block 1M grep -F -f - -n bigfile | \
           sort -un | perl -pe 's/^\d+://'

       The 1M should be your free memory divided by the number of CPU threads
       and divided by 200 for grep -F and by 1000 for normal grep. On
       GNU/Linux you can do:

         free=$(awk '/^((Swap)?Cached|MemFree|Buffers):/ { sum += $2 }
                     END { print sum }' /proc/meminfo)
         percpu=$((free / 200 / $(parallel --number-of-threads)))k

         parallel --pipepart -a regexps.txt --block $percpu --compress \
           grep -F -f - -n bigfile | \
           sort -un | perl -pe 's/^\d+://'

       If you can live with duplicated lines and wrong order, it is faster to
       do:

         parallel --pipepart -a regexps.txt --block $percpu --compress \
           grep -F -f - bigfile

       Limiting factor: CPU

       If the CPU is the limiting factor parallelization should be done on the
       regexps:

         cat regexps.txt | parallel --pipe -L1000 --roundrobin --compress \
           grep -f - -n bigfile | \
           sort -un | perl -pe 's/^\d+://'

       The command will start one grep per CPU and read bigfile one time per
       CPU, but as that is done in parallel, all reads except the first will
       be cached in RAM. Depending on the size of regexps.txt it may be faster
       to use --block 10m instead of -L1000.

       Some storage systems perform better when reading multiple chunks in
       parallel. This is true for some RAID systems and for some network file
       systems. To parallelize the reading of bigfile:

         parallel --pipepart --block 100M -a bigfile -k --compress \
           grep -f regexps.txt

       This will split bigfile into 100MB chunks and run grep on each of these
       chunks. To parallelize both reading of bigfile and regexps.txt combine
       the two using --cat:

         parallel --pipepart --block 100M -a bigfile --cat cat regexps.txt \
           \| parallel --pipe -L1000 --roundrobin grep -f - {}

       If a line matches multiple regexps, the line may be duplicated.

       Bigger problem

       If the problem is too big to be solved by this, you are probably ready
       for Lucene.

   EXAMPLE: Using remote computers
       To run commands on a remote computer SSH needs to be set up and you
       must be able to login without entering a password (The commands ssh-
       copy-id, ssh-agent, and sshpass may help you do that).

       If you need to login to a whole cluster, you typically do not want to
       accept the host key for every host. You want to accept them the first
       time and be warned if they are ever changed. To do that:

         # Add the servers to the sshloginfile
         (echo servera; echo serverb) > .parallel/my_cluster
         # Make sure .ssh/config exist
         touch .ssh/config
         cp .ssh/config .ssh/config.backup
         # Disable StrictHostKeyChecking temporarily
         (echo 'Host *'; echo StrictHostKeyChecking no) >> .ssh/config
         parallel --slf my_cluster --nonall true
         # Remove the disabling of StrictHostKeyChecking
         mv .ssh/config.backup .ssh/config

       The servers in .parallel/my_cluster are now added in .ssh/known_hosts.

       To run echo on server.example.com:

         seq 10 | parallel --sshlogin server.example.com echo

       To run commands on more than one remote computer run:

         seq 10 | parallel --sshlogin s1.example.com,s2.example.net echo

       Or:

         seq 10 | parallel --sshlogin server.example.com \
           --sshlogin server2.example.net echo

       If the login username is foo on server2.example.net use:

         seq 10 | parallel --sshlogin server.example.com \
           --sshlogin foo@server2.example.net echo

       If your list of hosts is server1-88.example.net with login foo:

         seq 10 | parallel -Sfoo@server{1..88}.example.net echo

       To distribute the commands to a list of computers, make a file
       mycomputers with all the computers:

         server.example.com
         foo@server2.example.com
         server3.example.com

       Then run:

         seq 10 | parallel --sshloginfile mycomputers echo

       To include the local computer add the special sshlogin ':' to the list:

         server.example.com
         foo@server2.example.com
         server3.example.com
         :

       GNU parallel will try to determine the number of CPUs on each of the
       remote computers, and run one job per CPU - even if the remote
       computers do not have the same number of CPUs.

       If the number of CPUs on the remote computers is not identified
       correctly the number of CPUs can be added in front. Here the computer
       has 8 CPUs.

         seq 10 | parallel --sshlogin 8/server.example.com echo

   EXAMPLE: Transferring of files
       To recompress gzipped files with bzip2 using a remote computer run:

         find logs/ -name '*.gz' | \
           parallel --sshlogin server.example.com \
           --transfer "zcat {} | bzip2 -9 >{.}.bz2"

       This will list the .gz-files in the logs directory and all directories
       below. Then it will transfer the files to server.example.com to the
       corresponding directory in $HOME/logs. On server.example.com the file
       will be recompressed using zcat and bzip2 resulting in the
       corresponding file with .gz replaced with .bz2.

       If you want the resulting bz2-file to be transferred back to the local
       computer add --return {.}.bz2:

         find logs/ -name '*.gz' | \
           parallel --sshlogin server.example.com \
           --transfer --return {.}.bz2 "zcat {} | bzip2 -9 >{.}.bz2"

       After the recompressing is done the .bz2-file is transferred back to
       the local computer and put next to the original .gz-file.

       If you want to delete the transferred files on the remote computer add
       --cleanup. This will remove both the file transferred to the remote
       computer and the files transferred from the remote computer:

         find logs/ -name '*.gz' | \
           parallel --sshlogin server.example.com \
           --transfer --return {.}.bz2 --cleanup "zcat {} | bzip2 -9 >{.}.bz2"

       If you want run on several computers add the computers to --sshlogin
       either using ',' or multiple --sshlogin:

         find logs/ -name '*.gz' | \
           parallel --sshlogin server.example.com,server2.example.com \
           --sshlogin server3.example.com \
           --transfer --return {.}.bz2 --cleanup "zcat {} | bzip2 -9 >{.}.bz2"

       You can add the local computer using --sshlogin :. This will disable
       the removing and transferring for the local computer only:

         find logs/ -name '*.gz' | \
           parallel --sshlogin server.example.com,server2.example.com \
           --sshlogin server3.example.com \
           --sshlogin : \
           --transfer --return {.}.bz2 --cleanup "zcat {} | bzip2 -9 >{.}.bz2"

       Often --transfer, --return and --cleanup are used together. They can be
       shortened to --trc:

         find logs/ -name '*.gz' | \
           parallel --sshlogin server.example.com,server2.example.com \
           --sshlogin server3.example.com \
           --sshlogin : \
           --trc {.}.bz2 "zcat {} | bzip2 -9 >{.}.bz2"

       With the file mycomputers containing the list of computers it becomes:

         find logs/ -name '*.gz' | parallel --sshloginfile mycomputers \
           --trc {.}.bz2 "zcat {} | bzip2 -9 >{.}.bz2"

       If the file ~/.parallel/sshloginfile contains the list of computers the
       special short hand -S .. can be used:

         find logs/ -name '*.gz' | parallel -S .. \
           --trc {.}.bz2 "zcat {} | bzip2 -9 >{.}.bz2"

   EXAMPLE: Advanced file transfer
       Assume you have files in in/*, want them processed on server, and
       transferred back into /other/dir:

         parallel -S server --trc /other/dir/./{/}.out \
           cp {/} {/}.out ::: in/./*

   EXAMPLE: Distributing work to local and remote computers
       Convert *.mp3 to *.ogg running one process per CPU on local computer
       and server2:

         parallel --trc {.}.ogg -S server2,: \
           'mpg321 -w - {} | oggenc -q0 - -o {.}.ogg' ::: *.mp3

   EXAMPLE: Running the same command on remote computers
       To run the command uptime on remote computers you can do:

         parallel --tag --nonall -S server1,server2 uptime

       --nonall reads no arguments. If you have a list of jobs you want to run
       on each computer you can do:

         parallel --tag --onall -S server1,server2 echo ::: 1 2 3

       Remove --tag if you do not want the sshlogin added before the output.

       If you have a lot of hosts use '-j0' to access more hosts in parallel.

   EXAMPLE: Running 'sudo' on remote computers
       Put the password into passwordfile then run:

         parallel --ssh 'cat passwordfile | ssh' --nonall \
           -S user@server1,user@server2 sudo -S ls -l /root

   EXAMPLE: Using remote computers behind NAT wall
       If the workers are behind a NAT wall, you need some trickery to get to
       them.

       If you can ssh to a jumphost, and reach the workers from there, then
       the obvious solution would be this, but it does not work:

         parallel --ssh 'ssh jumphost ssh' -S host1 echo ::: DOES NOT WORK

       It does not work because the command is dequoted by ssh twice where as
       GNU parallel only expects it to be dequoted once.

       You can use a bash function and have GNU parallel quote the command:

         jumpssh() { ssh -A jumphost ssh $(parallel --shellquote ::: "$@"); }
         export -f jumpssh
         parallel --ssh jumpssh -S host1 echo ::: this works

       Or you can instead put this in ~/.ssh/config:

         Host host1 host2 host3
           ProxyCommand ssh jumphost.domain nc -w 1 %h 22

       It requires nc(netcat) to be installed on jumphost. With this you can
       simply:

         parallel -S host1,host2,host3 echo ::: This does work

       No jumphost, but port forwards

       If there is no jumphost but each server has port 22 forwarded from the
       firewall (e.g. the firewall's port 22001 = port 22 on host1, 22002 =
       host2, 22003 = host3) then you can use ~/.ssh/config:

         Host host1.v
           Port 22001
         Host host2.v
           Port 22002
         Host host3.v
           Port 22003
         Host *.v
           Hostname firewall

       And then use host{1..3}.v as normal hosts:

         parallel -S host1.v,host2.v,host3.v echo ::: a b c

       No jumphost, no port forwards

       If ports cannot be forwarded, you need some sort of VPN to traverse the
       NAT-wall. TOR is one options for that, as it is very easy to get
       working.

       You need to install TOR and setup a hidden service. In torrc put:

         HiddenServiceDir /var/lib/tor/hidden_service/
         HiddenServicePort 22 127.0.0.1:22

       Then start TOR: /etc/init.d/tor restart

       The TOR hostname is now in /var/lib/tor/hidden_service/hostname and is
       something similar to izjafdceobowklhz.onion. Now you simply prepend
       torsocks to ssh:

         parallel --ssh 'torsocks ssh' -S izjafdceobowklhz.onion \
           -S zfcdaeiojoklbwhz.onion,auclucjzobowklhi.onion echo ::: a b c

       If not all hosts are accessible through TOR:

         parallel -S 'torsocks ssh izjafdceobowklhz.onion,host2,host3' \
           echo ::: a b c

       See more ssh tricks on
       https://en.wikibooks.org/wiki/OpenSSH/Cookbook/Proxies_and_Jump_Hosts

   EXAMPLE: Use outrun instead of ssh
       outrun lets you run a command on a remote server. outrun sets up a
       connection to access files at the source server, and automatically
       transfers files. outrun must be installed on the remote system.

       You can use outrun in an sshlogin this way:

         parallel -S 'outrun user@server eval' command

   EXAMPLE: Slurm cluster
       The Slurm Workload Manager is used in many clusters.

       Here is a simple example of using GNU parallel to call srun:

         #!/bin/bash

         #SBATCH --time 00:02:00
         #SBATCH --ntasks=4
         #SBATCH --job-name GnuParallelDemo
         #SBATCH --output gnuparallel.out

         module purge
         module load gnu_parallel

         my_parallel="parallel --delay .2 -j $SLURM_NTASKS"
         my_srun="srun --export=all --exclusive -n1 --cpus-per-task=1 --cpu-bind=cores"
         $my_parallel "$my_srun" echo This is job {} ::: {1..20}

   EXAMPLE: Parallelizing rsync
       rsync is a great tool, but sometimes it will not fill up the available
       bandwidth. Running multiple rsync in parallel can fix this.

         cd src-dir
         find . -type f |
           parallel -j10 -X rsync -zR -Ha ./{} fooserver:/dest-dir/

       Adjust -j10 until you find the optimal number.

       rsync -R will create the needed subdirectories, so all files are not
       put into a single dir. The ./ is needed so the resulting command looks
       similar to:

         rsync -zR ././sub/dir/file fooserver:/dest-dir/

       The /./ is what rsync -R works on.

       If you are unable to push data, but need to pull them and the files are
       called digits.png (e.g. 000000.png) you might be able to do:

         seq -w 0 99 | parallel rsync -Havessh fooserver:src/*{}.png destdir/

   EXAMPLE: Use multiple inputs in one command
       Copy files like foo.es.ext to foo.ext:

         ls *.es.* | perl -pe 'print; s/\.es//' | parallel -N2 cp {1} {2}

       The perl command spits out 2 lines for each input. GNU parallel takes 2
       inputs (using -N2) and replaces {1} and {2} with the inputs.

       Count in binary:

         parallel -k echo ::: 0 1 ::: 0 1 ::: 0 1 ::: 0 1 ::: 0 1 ::: 0 1

       Print the number on the opposing sides of a six sided die:

         parallel --link -a <(seq 6) -a <(seq 6 -1 1) echo
         parallel --link echo :::: <(seq 6) <(seq 6 -1 1)

       Convert files from all subdirs to PNG-files with consecutive numbers
       (useful for making input PNG's for ffmpeg):

         parallel --link -a <(find . -type f | sort) \
           -a <(seq $(find . -type f|wc -l)) convert {1} {2}.png

       Alternative version:

         find . -type f | sort | parallel convert {} {#}.png

   EXAMPLE: Use a table as input
       Content of table_file.tsv:

         foo<TAB>bar
         baz <TAB> quux

       To run:

         cmd -o bar -i foo
         cmd -o quux -i baz

       you can run:

         parallel -a table_file.tsv --colsep '\t' cmd -o {2} -i {1}

       Note: The default for GNU parallel is to remove the spaces around the
       columns. To keep the spaces:

         parallel -a table_file.tsv --trim n --colsep '\t' cmd -o {2} -i {1}

   EXAMPLE: Output to database
       GNU parallel can output to a database table and a CSV-file:

         dburl=csv:///%2Ftmp%2Fmydir
         dbtableurl=$dburl/mytable.csv
         parallel --sqlandworker $dbtableurl seq ::: {1..10}

       It is rather slow and takes up a lot of CPU time because GNU parallel
       parses the whole CSV file for each update.

       A better approach is to use an SQLite-base and then convert that to
       CSV:

         dburl=sqlite3:///%2Ftmp%2Fmy.sqlite
         dbtableurl=$dburl/mytable
         parallel --sqlandworker $dbtableurl seq ::: {1..10}
         sql $dburl '.headers on' '.mode csv' 'SELECT * FROM mytable;'

       This takes around a second per job.

       If you have access to a real database system, such as PostgreSQL, it is
       even faster:

         dburl=pg://user:pass@host/mydb
         dbtableurl=$dburl/mytable
         parallel --sqlandworker $dbtableurl seq ::: {1..10}
         sql $dburl \
           "COPY (SELECT * FROM mytable) TO stdout DELIMITER ',' CSV HEADER;"

       Or MySQL:

         dburl=mysql://user:pass@host/mydb
         dbtableurl=$dburl/mytable
         parallel --sqlandworker $dbtableurl seq ::: {1..10}
         sql -p -B $dburl "SELECT * FROM mytable;" > mytable.tsv
         perl -pe 's/"/""/g; s/\t/","/g; s/^/"/; s/$/"/;
           %s=("\\" => "\\", "t" => "\t", "n" => "\n");
           s/\\([\\tn])/$s{$1}/g;' mytable.tsv

   EXAMPLE: Output to CSV-file for R
       If you have no need for the advanced job distribution control that a
       database provides, but you simply want output into a CSV file that you
       can read into R or LibreCalc, then you can use --results:

         parallel --results my.csv seq ::: 10 20 30
         R
         > mydf <- read.csv("my.csv");
         > print(mydf[2,])
         > write(as.character(mydf[2,c("Stdout")]),'')

   EXAMPLE: Use XML as input
       The show Aflyttet on Radio 24syv publishes an RSS feed with their audio
       podcasts on: http://arkiv.radio24syv.dk/audiopodcast/channel/4466232

       Using xpath you can extract the URLs for 2019 and download them using
       GNU parallel:

         wget -O - http://arkiv.radio24syv.dk/audiopodcast/channel/4466232 | \
           xpath -e "//pubDate[contains(text(),'2019')]/../enclosure/@url" | \
           parallel -u wget '{= s/ url="//; s/"//; =}'

   EXAMPLE: Run the same command 10 times
       If you want to run the same command with the same arguments 10 times in
       parallel you can do:

         seq 10 | parallel -n0 my_command my_args

   EXAMPLE: Working as cat | sh. Resource inexpensive jobs and evaluation
       GNU parallel can work similar to cat | sh.

       A resource inexpensive job is a job that takes very little CPU, disk
       I/O and network I/O. Ping is an example of a resource inexpensive job.
       wget is too - if the webpages are small.

       The content of the file jobs_to_run:

         ping -c 1 10.0.0.1
         wget http://example.com/status.cgi?ip=10.0.0.1
         ping -c 1 10.0.0.2
         wget http://example.com/status.cgi?ip=10.0.0.2
         ...
         ping -c 1 10.0.0.255
         wget http://example.com/status.cgi?ip=10.0.0.255

       To run 100 processes simultaneously do:

         parallel -j 100 < jobs_to_run

       As there is not a command the jobs will be evaluated by the shell.

   EXAMPLE: Call program with FASTA sequence
       FASTA files have the format:

         >Sequence name1
         sequence
         sequence continued
         >Sequence name2
         sequence
         sequence continued
         more sequence

       To call myprog with the sequence as argument run:

         cat file.fasta |
           parallel --pipe -N1 --recstart '>' --rrs \
             'read a; echo Name: "$a"; myprog $(tr -d "\n")'

   EXAMPLE: Call program with interleaved FASTQ records
       FASTQ files have the format:

         @M10991:61:000000000-A7EML:1:1101:14011:1001 1:N:0:28
         CTCCTAGGTCGGCATGATGGGGGAAGGAGAGCATGGGAAGAAATGAGAGAGTAGCAAGG
         +
         #8BCCGGGGGFEFECFGGGGGGGGG@;FFGGGEG@FF<EE<@FFC,CEGCCGGFF<FGF

       Interleaved FASTQ starts with a line like these:

         @HWUSI-EAS100R:6:73:941:1973#0/1
         @EAS139:136:FC706VJ:2:2104:15343:197393 1:Y:18:ATCACG
         @EAS139:136:FC706VJ:2:2104:15343:197393 1:N:18:1

       where '/1' and ' 1:' determines this is read 1.

       This will cut big.fq into one chunk per CPU core and pass it on stdin
       (standard input) to the program fastq-reader:

         parallel --pipepart -a big.fq --block -1 --regexp \
           --recend '\n' --recstart '@.*(/1| 1:.*)\n[A-Za-z\n\.~]' \
           fastq-reader

   EXAMPLE: Processing a big file using more CPUs
       To process a big file or some output you can use --pipe to split up the
       data into blocks and pipe the blocks into the processing program.

       If the program is gzip -9 you can do:

         cat bigfile | parallel --pipe --recend '' -k gzip -9 > bigfile.gz

       This will split bigfile into blocks of 1 MB and pass that to gzip -9 in
       parallel. One gzip will be run per CPU. The output of gzip -9 will be
       kept in order and saved to bigfile.gz

       gzip works fine if the output is appended, but some processing does not
       work like that - for example sorting. For this GNU parallel can put the
       output of each command into a file. This will sort a big file in
       parallel:

         cat bigfile | parallel --pipe --files sort |\
           parallel -Xj1 sort -m {} ';' rm {} >bigfile.sort

       Here bigfile is split into blocks of around 1MB, each block ending in
       '\n' (which is the default for --recend). Each block is passed to sort
       and the output from sort is saved into files. These files are passed to
       the second parallel that runs sort -m on the files before it removes
       the files. The output is saved to bigfile.sort.

       GNU parallel's --pipe maxes out at around 100 MB/s because every byte
       has to be copied through GNU parallel. But if bigfile is a real
       (seekable) file GNU parallel can by-pass the copying and send the parts
       directly to the program:

         parallel --pipepart --block 100m -a bigfile --files sort |\
           parallel -Xj1 sort -m {} ';' rm {} >bigfile.sort

   EXAMPLE: Grouping input lines
       When processing with --pipe you may have lines grouped by a value. Here
       is my.csv:

          Transaction Customer Item
               1       a       53
               2       b       65
               3       b       82
               4       c       96
               5       c       67
               6       c       13
               7       d       90
               8       d       43
               9       d       91
               10      d       84
               11      e       72
               12      e       102
               13      e       63
               14      e       56
               15      e       74

       Let us assume you want GNU parallel to process each customer. In other
       words: You want all the transactions for a single customer to be
       treated as a single record.

       To do this we preprocess the data with a program that inserts a record
       separator before each customer (column 2 = $F[1]). Here we first make a
       50 character random string, which we then use as the separator:

         sep=`perl -e 'print map { ("a".."z","A".."Z")[rand(52)] } (1..50);'`
         cat my.csv | \
            perl -ape '$F[1] ne $l and print "'$sep'"; $l = $F[1]' | \
            parallel --recend $sep --rrs --pipe -N1 wc

       If your program can process multiple customers replace -N1 with a
       reasonable --blocksize.

   EXAMPLE: Running more than 250 jobs workaround
       If you need to run a massive amount of jobs in parallel, then you will
       likely hit the filehandle limit which is often around 250 jobs. If you
       are super user you can raise the limit in /etc/security/limits.conf but
       you can also use this workaround. The filehandle limit is per process.
       That means that if you just spawn more GNU parallels then each of them
       can run 250 jobs. This will spawn up to 2500 jobs:

         cat myinput |\
           parallel --pipe -N 50 --roundrobin -j50 parallel -j50 your_prg

       This will spawn up to 62500 jobs (use with caution - you need 64 GB RAM
       to do this, and you may need to increase /proc/sys/kernel/pid_max):

         cat myinput |\
           parallel --pipe -N 250 --roundrobin -j250 parallel -j250 your_prg

   EXAMPLE: Working as mutex and counting semaphore
       The command sem is an alias for parallel --semaphore.

       A counting semaphore will allow a given number of jobs to be started in
       the background.  When the number of jobs are running in the background,
       GNU sem will wait for one of these to complete before starting another
       command. sem --wait will wait for all jobs to complete.

       Run 10 jobs concurrently in the background:

         for i in *.log ; do
           echo $i
           sem -j10 gzip $i ";" echo done
         done
         sem --wait

       A mutex is a counting semaphore allowing only one job to run. This will
       edit the file myfile and prepends the file with lines with the numbers
       1 to 3.

         seq 3 | parallel sem sed -i -e '1i{}' myfile

       As myfile can be very big it is important only one process edits the
       file at the same time.

       Name the semaphore to have multiple different semaphores active at the
       same time:

         seq 3 | parallel sem --id mymutex sed -i -e '1i{}' myfile

   EXAMPLE: Mutex for a script
       Assume a script is called from cron or from a web service, but only one
       instance can be run at a time. With sem and --shebang-wrap the script
       can be made to wait for other instances to finish. Here in bash:

         #!/usr/bin/sem --shebang-wrap -u --id $0 --fg /bin/bash

         echo This will run
         sleep 5
         echo exclusively

       Here perl:

         #!/usr/bin/sem --shebang-wrap -u --id $0 --fg /usr/bin/perl

         print "This will run ";
         sleep 5;
         print "exclusively\n";

       Here python:

         #!/usr/local/bin/sem --shebang-wrap -u --id $0 --fg /usr/bin/python

         import time
         print "This will run ";
         time.sleep(5)
         print "exclusively";

   EXAMPLE: Start editor with filenames from stdin (standard input)
       You can use GNU parallel to start interactive programs like emacs or
       vi:

         cat filelist | parallel --tty -X emacs
         cat filelist | parallel --tty -X vi

       If there are more files than will fit on a single command line, the
       editor will be started again with the remaining files.

   EXAMPLE: Running sudo
       sudo requires a password to run a command as root. It caches the
       access, so you only need to enter the password again if you have not
       used sudo for a while.

       The command:

         parallel sudo echo ::: This is a bad idea

       is no good, as you would be prompted for the sudo password for each of
       the jobs. You can either do:

         sudo echo This
         parallel sudo echo ::: is a good idea

       or:

         sudo parallel echo ::: This is a good idea

       This way you only have to enter the sudo password once.

   EXAMPLE: GNU Parallel as queue system/batch manager
       GNU parallel can work as a simple job queue system or batch manager.
       The idea is to put the jobs into a file and have GNU parallel read from
       that continuously. As GNU parallel will stop at end of file we use tail
       to continue reading:

         true >jobqueue; tail -n+0 -f jobqueue | parallel

       To submit your jobs to the queue:

         echo my_command my_arg >> jobqueue

       You can of course use -S to distribute the jobs to remote computers:

         true >jobqueue; tail -n+0 -f jobqueue | parallel -S ..

       Output only will be printed when reading the next input after a job has
       finished: So you need to submit a job after the first has finished to
       see the output from the first job.

       If you keep this running for a long time, jobqueue will grow. A way of
       removing the jobs already run is by making GNU parallel stop when it
       hits a special value and then restart. To use --eof to make GNU
       parallel exit, tail also needs to be forced to exit:

         true >jobqueue;
         while true; do
           tail -n+0 -f jobqueue |
             (parallel -E StOpHeRe -S ..; echo GNU Parallel is now done;
              perl -e 'while(<>){/StOpHeRe/ and last};print <>' jobqueue > j2;
              (seq 1000 >> jobqueue &);
              echo Done appending dummy data forcing tail to exit)
           echo tail exited;
           mv j2 jobqueue
         done

       In some cases you can run on more CPUs and computers during the night:

         # Day time
         echo 50% > jobfile
         cp day_server_list ~/.parallel/sshloginfile
         # Night time
         echo 100% > jobfile
         cp night_server_list ~/.parallel/sshloginfile
         tail -n+0 -f jobqueue | parallel --jobs jobfile -S ..

       GNU parallel discovers if jobfile or ~/.parallel/sshloginfile changes.

   EXAMPLE: GNU Parallel as dir processor
       If you have a dir in which users drop files that needs to be processed
       you can do this on GNU/Linux (If you know what inotifywait is called on
       other platforms file a bug report):

         inotifywait -qmre MOVED_TO -e CLOSE_WRITE --format %w%f my_dir |\
           parallel -u echo

       This will run the command echo on each file put into my_dir or subdirs
       of my_dir.

       You can of course use -S to distribute the jobs to remote computers:

         inotifywait -qmre MOVED_TO -e CLOSE_WRITE --format %w%f my_dir |\
           parallel -S ..  -u echo

       If the files to be processed are in a tar file then unpacking one file
       and processing it immediately may be faster than first unpacking all
       files. Set up the dir processor as above and unpack into the dir.

       Using GNU parallel as dir processor has the same limitations as using
       GNU parallel as queue system/batch manager.

   EXAMPLE: Locate the missing package
       If you have downloaded source and tried compiling it, you may have
       seen:

         $ ./configure
         [...]
         checking for something.h... no
         configure: error: "libsomething not found"

       Often it is not obvious which package you should install to get that
       file. Debian has `apt-file` to search for a file. `tracefile` from
       https://gitlab.com/ole.tange/tangetools can tell which files a program
       tried to access. In this case we are interested in one of the last
       files:

         $ tracefile -un ./configure | tail | parallel -j0 apt-file search

SPREADING BLOCKS OF DATA
       --round-robin, --pipe-part, --shard, --bin and --group-by are all
       specialized versions of --pipe.

       In the following n is the number of jobslots given by --jobs. A record
       starts with --recstart and ends with --recend. It is typically a full
       line. A chunk is a number of full records that is approximately the
       size of a block. A block can contain half records, a chunk cannot.

       --pipe starts one job per chunk. It reads blocks from stdin (standard
       input). It finds a record end near a block border and passes a chunk to
       the program.

       --pipe-part starts one job per chunk - just like normal --pipe. It
       first finds record endings near all block borders in the file and then
       starts the jobs. By using --block -1 it will set the block size to 1/n
       * size-of-file. Used this way it will start n jobs in total.

       --round-robin starts n jobs in total. It reads a block and passes a
       chunk to whichever job is ready to read. It does not parse the content
       except for identifying where a record ends to make sure it only passes
       full records.

       --shard starts n jobs in total. It parses each line to read the value
       in the given column. Based on this value the line is passed to one of
       the n jobs. All lines having this value will be given to the same
       jobslot.

       --bin works like --shard but the value of the column is the jobslot
       number it will be passed to. If the value is bigger than n, then n will
       be subtracted from the value until the values is smaller than or equal
       to n.

       --group-by starts one job per chunk. Record borders are not given by
       --recend/--recstart. Instead a record is defined by a number of lines
       having the same value in a given column. So the value of a given column
       changes at a chunk border. With --pipe every line is parsed, with
       --pipe-part only a few lines are parsed to find the chunk border.

       --group-by can be combined with --round-robin or --pipe-part.

UNIT PREFIX
       Many numerical arguments in GNU parallel can be postfixed with K, M, G,
       T, P, k, m, g, t, or p which would multiply the number with 1024,
       1048576, 1073741824, 1099511627776, 1125899906842624, 1000, 1000000,
       1000000000, 1000000000000, or 1000000000000000, respectively.

       You can even give it as a math expression. E.g. 1000000 can be written
       as 1M-12*2.024*2k.

QUOTING
       GNU parallel is very liberal in quoting. You only need to quote
       characters that have special meaning in shell:

         ( ) $ ` ' " < > ; | \

       and depending on context these needs to be quoted, too:

         ~ & # ! ? space * {

       Therefore most people will never need more quoting than putting '\' in
       front of the special characters.

       Often you can simply put \' around every ':

         perl -ne '/^\S+\s+\S+$/ and print $ARGV,"\n"' file

       can be quoted:

         parallel perl -ne \''/^\S+\s+\S+$/ and print $ARGV,"\n"'\' ::: file

       However, when you want to use a shell variable you need to quote the
       $-sign. Here is an example using $PARALLEL_SEQ. This variable is set by
       GNU parallel itself, so the evaluation of the $ must be done by the sub
       shell started by GNU parallel:

         seq 10 | parallel -N2 echo seq:\$PARALLEL_SEQ arg1:{1} arg2:{2}

       If the variable is set before GNU parallel starts you can do this:

         VAR=this_is_set_before_starting
         echo test | parallel echo {} $VAR

       Prints: test this_is_set_before_starting

       It is a little more tricky if the variable contains more than one space
       in a row:

         VAR="two  spaces  between  each  word"
         echo test | parallel echo {} \'"$VAR"\'

       Prints: test two  spaces  between  each  word

       If the variable should not be evaluated by the shell starting GNU
       parallel but be evaluated by the sub shell started by GNU parallel,
       then you need to quote it:

         echo test | parallel VAR=this_is_set_after_starting \; echo {} \$VAR

       Prints: test this_is_set_after_starting

       It is a little more tricky if the variable contains space:

         echo test |\
           parallel VAR='"two  spaces  between  each  word"' echo {} \'"$VAR"\'

       Prints: test two  spaces  between  each  word

       $$ is the shell variable containing the process id of the shell. This
       will print the process id of the shell running GNU parallel:

         seq 10 | parallel echo $$

       And this will print the process ids of the sub shells started by GNU
       parallel.

         seq 10 | parallel echo \$\$

       If the special characters should not be evaluated by the sub shell then
       you need to protect it against evaluation from both the shell starting
       GNU parallel and the sub shell:

         echo test | parallel echo {} \\\$VAR

       Prints: test $VAR

       GNU parallel can protect against evaluation by the sub shell by using
       -q:

         echo test | parallel -q echo {} \$VAR

       Prints: test $VAR

       This is particularly useful if you have lots of quoting. If you want to
       run a perl script like this:

         perl -ne '/^\S+\s+\S+$/ and print $ARGV,"\n"' file

       It needs to be quoted like one of these:

         ls | parallel perl -ne '/^\\S+\\s+\\S+\$/\ and\ print\ \$ARGV,\"\\n\"'
         ls | parallel perl -ne \''/^\S+\s+\S+$/ and print $ARGV,"\n"'\'

       Notice how spaces, \'s, "'s, and $'s need to be quoted. GNU parallel
       can do the quoting by using option -q:

         ls | parallel -q  perl -ne '/^\S+\s+\S+$/ and print $ARGV,"\n"'

       However, this means you cannot make the sub shell interpret special
       characters. For example because of -q this WILL NOT WORK:

         ls *.gz | parallel -q "zcat {} >{.}"
         ls *.gz | parallel -q "zcat {} | bzip2 >{.}.bz2"

       because > and | need to be interpreted by the sub shell.

       If you get errors like:

         sh: -c: line 0: syntax error near unexpected token
         sh: Syntax error: Unterminated quoted string
         sh: -c: line 0: unexpected EOF while looking for matching `''
         sh: -c: line 1: syntax error: unexpected end of file
         zsh:1: no matches found:

       then you might try using -q.

       If you are using bash process substitution like <(cat foo) then you may
       try -q and prepending command with bash -c:

         ls | parallel -q bash -c 'wc -c <(echo {})'

       Or for substituting output:

         ls | parallel -q bash -c \
           'tar c {} | tee >(gzip >{}.tar.gz) | bzip2 >{}.tar.bz2'

       Conclusion: To avoid dealing with the quoting problems it may be easier
       just to write a small script or a function (remember to export -f the
       function) and have GNU parallel call that.

LIST RUNNING JOBS
       If you want a list of the jobs currently running you can run:

         killall -USR1 parallel

       GNU parallel will then print the currently running jobs on stderr
       (standard error).

COMPLETE RUNNING JOBS BUT DO NOT START NEW JOBS
       If you regret starting a lot of jobs you can simply break GNU parallel,
       but if you want to make sure you do not have half-completed jobs you
       should send the signal SIGHUP to GNU parallel:

         killall -HUP parallel

       This will tell GNU parallel to not start any new jobs, but wait until
       the currently running jobs are finished before exiting.

ENVIRONMENT VARIABLES
       $PARALLEL_HOME
                Dir where GNU parallel stores config files, semaphores, and
                caches information between invocations. Default:
                $HOME/.parallel.

       $PARALLEL_ARGHOSTGROUPS
                When using --hostgroups GNU parallel sets this to the
                hostgroups of the job.

                Remember to quote the $, so it gets evaluated by the correct
                shell. Or use --plus and {agrp}.

       $PARALLEL_HOSTGROUPS
                When using --hostgroups GNU parallel sets this to the
                hostgroups of the sshlogin that the job is run on.

                Remember to quote the $, so it gets evaluated by the correct
                shell. Or use --plus and {hgrp}.

       $PARALLEL_JOBSLOT
                Set by GNU parallel and can be used in jobs run by GNU
                parallel.  Remember to quote the $, so it gets evaluated by
                the correct shell. Or use --plus and {slot}.

                $PARALLEL_JOBSLOT is the jobslot of the job. It is equal to
                {%} unless the job is being retried. See {%} for details.

       $PARALLEL_PID
                Set by GNU parallel and can be used in jobs run by GNU
                parallel.  Remember to quote the $, so it gets evaluated by
                the correct shell.

                This makes it possible for the jobs to communicate directly to
                GNU parallel.

                Example: If each of the jobs tests a solution and one of jobs
                finds the solution the job can tell GNU parallel not to start
                more jobs by: kill -HUP $PARALLEL_PID. This only works on the
                local computer.

       $PARALLEL_RSYNC_OPTS
                Options to pass on to rsync. Defaults to: -rlDzR.

       $PARALLEL_SHELL
                Use this shell for the commands run by GNU parallel:

                o $PARALLEL_SHELL. If undefined use:

                o The shell that started GNU parallel. If that cannot be
                  determined:

                o $SHELL. If undefined use:

                o /bin/sh

       $PARALLEL_SSH
                GNU parallel defaults to using the ssh command for remote
                access. This can be overridden with $PARALLEL_SSH, which again
                can be overridden with --ssh. It can also be set on a per
                server basis (see --sshlogin).

       $PARALLEL_SSHHOST
                Set by GNU parallel and can be used in jobs run by GNU
                parallel.  Remember to quote the $, so it gets evaluated by
                the correct shell. Or use --plus and {host}.

                $PARALLEL_SSHHOST is the host part of an sshlogin line. E.g.

                  4//usr/bin/specialssh user@host

                becomes:

                  host

       $PARALLEL_SSHLOGIN
                Set by GNU parallel and can be used in jobs run by GNU
                parallel.  Remember to quote the $, so it gets evaluated by
                the correct shell. Or use --plus and {sshlogin}.

                The value is the sshlogin line with number of cores removed.
                E.g.

                  4//usr/bin/specialssh user@host

                becomes:

                  /usr/bin/specialssh user@host

       $PARALLEL_SEQ
                Set by GNU parallel and can be used in jobs run by GNU
                parallel.  Remember to quote the $, so it gets evaluated by
                the correct shell.

                $PARALLEL_SEQ is the sequence number of the job running.

                Example:

                  seq 10 | parallel -N2 \
                    echo seq:'$'PARALLEL_SEQ arg1:{1} arg2:{2}

                {#} is a shorthand for $PARALLEL_SEQ.

       $PARALLEL_TMUX
                Path to tmux. If unset the tmux in $PATH is used.

       $TMPDIR  Directory for temporary files. See: --tmpdir.

       $PARALLEL
                The environment variable $PARALLEL will be used as default
                options for GNU parallel. If the variable contains special
                shell characters (e.g. $, *, or space) then these need to be
                to be escaped with \.

                Example:

                  cat list | parallel -j1 -k -v ls
                  cat list | parallel -j1 -k -v -S"myssh user@server" ls

                can be written as:

                  cat list | PARALLEL="-kvj1" parallel ls
                  cat list | PARALLEL='-kvj1 -S myssh\ user@server' \
                    parallel echo

                Notice the \ after 'myssh' is needed because 'myssh' and
                'user@server' must be one argument.

DEFAULT PROFILE (CONFIG FILE)
       The global configuration file /etc/parallel/config, followed by user
       configuration file ~/.parallel/config (formerly known as .parallelrc)
       will be read in turn if they exist.  Lines starting with '#' will be
       ignored. The format can follow that of the environment variable
       $PARALLEL, but it is often easier to simply put each option on its own
       line.

       Options on the command line take precedence, followed by the
       environment variable $PARALLEL, user configuration file
       ~/.parallel/config, and finally the global configuration file
       /etc/parallel/config.

       Note that no file that is read for options, nor the environment
       variable $PARALLEL, may contain retired options such as --tollef.

PROFILE FILES
       If --profile set, GNU parallel will read the profile from that file
       rather than the global or user configuration files. You can have
       multiple --profiles.

       Profiles are searched for in ~/.parallel. If the name starts with / it
       is seen as an absolute path. If the name starts with ./ it is seen as a
       relative path from current dir.

       Example: Profile for running a command on every sshlogin in
       ~/.ssh/sshlogins and prepend the output with the sshlogin:

         echo --tag -S .. --nonall > ~/.parallel/nonall_profile
         parallel -J nonall_profile uptime

       Example: Profile for running every command with -j-1 and nice

         echo -j-1 nice > ~/.parallel/nice_profile
         parallel -J nice_profile bzip2 -9 ::: *

       Example: Profile for running a perl script before every command:

         echo "perl -e '\$a=\$\$; print \$a,\" \",'\$PARALLEL_SEQ',\" \";';" \
           > ~/.parallel/pre_perl
         parallel -J pre_perl echo ::: *

       Note how the $ and " need to be quoted using \.

       Example: Profile for running distributed jobs with nice on the remote
       computers:

         echo -S .. nice > ~/.parallel/dist
         parallel -J dist --trc {.}.bz2 bzip2 -9 ::: *

EXIT STATUS
       Exit status depends on --halt-on-error if one of these is used:
       success=X, success=Y%, fail=Y%.

       0     All jobs ran without error. If success=X is used: X jobs ran
             without error. If success=Y% is used: Y% of the jobs ran without
             error.

       1-100 Some of the jobs failed. The exit status gives the number of
             failed jobs. If Y% is used the exit status is the percentage of
             jobs that failed.

       101   More than 100 jobs failed.

       255   Other error.

       -1 (In joblog and SQL table)
             Killed by Ctrl-C, timeout, not enough memory or similar.

       -2 (In joblog and SQL table)
             skip() was called in {= =}.

       -1000 (In SQL table)
             Job is ready to run (set by --sqlmaster).

       -1220 (In SQL table)
             Job is taken by worker (set by --sqlworker).

       If fail=1 is used, the exit status will be the exit status of the
       failing job.

DIFFERENCES BETWEEN GNU Parallel AND ALTERNATIVES
       See: man parallel_alternatives

BUGS
   Quoting of newline
       Because of the way newline is quoted this will not work:

         echo 1,2,3 | parallel -vkd, "echo 'a{}b'"

       However, these will all work:

         echo 1,2,3 | parallel -vkd, echo a{}b
         echo 1,2,3 | parallel -vkd, "echo 'a'{}'b'"
         echo 1,2,3 | parallel -vkd, "echo 'a'"{}"'b'"

   Speed
       Startup

       GNU parallel is slow at starting up - around 250 ms the first time and
       150 ms after that.

       Job startup

       Starting a job on the local machine takes around 10 ms. This can be a
       big overhead if the job takes very few ms to run. Often you can group
       small jobs together using -X which will make the overhead less
       significant. Or you can run multiple GNU parallels as described in
       EXAMPLE: Speeding up fast jobs.

       SSH

       When using multiple computers GNU parallel opens ssh connections to
       them to figure out how many connections can be used reliably
       simultaneously (Namely SSHD's MaxStartups). This test is done for each
       host in serial, so if your --sshloginfile contains many hosts it may be
       slow.

       If your jobs are short you may see that there are fewer jobs running on
       the remote systems than expected. This is due to time spent logging in
       and out. -M may help here.

       Disk access

       A single disk can normally read data faster if it reads one file at a
       time instead of reading a lot of files in parallel, as this will avoid
       disk seeks. However, newer disk systems with multiple drives can read
       faster if reading from multiple files in parallel.

       If the jobs are of the form read-all-compute-all-write-all, so
       everything is read before anything is written, it may be faster to
       force only one disk access at the time:

         sem --id diskio cat file | compute | sem --id diskio cat > file

       If the jobs are of the form read-compute-write, so writing starts
       before all reading is done, it may be faster to force only one reader
       and writer at the time:

         sem --id read cat file | compute | sem --id write cat > file

       If the jobs are of the form read-compute-read-compute, it may be faster
       to run more jobs in parallel than the system has CPUs, as some of the
       jobs will be stuck waiting for disk access.

   --nice limits command length
       The current implementation of --nice is too pessimistic in the max
       allowed command length. It only uses a little more than half of what it
       could. This affects -X and -m. If this becomes a real problem for you,
       file a bug-report.

   Aliases and functions do not work
       If you get:

         Can't exec "command": No such file or directory

       or:

         open3: exec of by command failed

       or:

         /bin/bash: command: command not found

       it may be because command is not known, but it could also be because
       command is an alias or a function. If it is a function you need to
       export -f the function first or use env_parallel. An alias will only
       work if you use env_parallel.

   Database with MySQL fails randomly
       The --sql* options may fail randomly with MySQL. This problem does not
       exist with PostgreSQL.

REPORTING BUGS
       Report bugs to <bug-parallel@gnu.org> or
       https://savannah.gnu.org/bugs/?func=additem&group=parallel

       When you write your report, please keep in mind, that you must give the
       reader enough information to be able to run exactly what you run. So
       you need to include all data and programs that you use to show the
       problem.

       See a perfect bug report on
       https://lists.gnu.org/archive/html/bug-parallel/2015-01/msg00000.html

       Your bug report should always include:

       o The error message you get (if any). If the error message is not from
         GNU parallel you need to show why you think GNU parallel caused this.

       o The complete output of parallel --version. If you are not running the
         latest released version (see https://ftp.gnu.org/gnu/parallel/) you
         should specify why you believe the problem is not fixed in that
         version.

       o A minimal, complete, and verifiable example (See description on
         https://stackoverflow.com/help/mcve).

         It should be a complete example that others can run which shows the
         problem including all files needed to run the example. This should
         preferably be small and simple, so try to remove as many options as
         possible.

         A combination of yes, seq, cat, echo, wc, and sleep can reproduce
         most errors.

         If your example requires large files, see if you can make them with
         something like seq 100000000 > bigfile or yes | head -n 1000000000 >
         file. If you need multiple columns: paste <(seq 1000) <(seq 1000
         1999)

         If your example requires remote execution, see if you can use
         localhost - maybe using another login.

         If you have access to a different system (maybe a VirtualBox on your
         own machine), test if your MCVE shows the problem on that system. If
         it does not, read below.

       o The output of your example. If your problem is not easily reproduced
         by others, the output might help them figure out the problem.

       o Whether you have watched the intro videos
         (https://www.youtube.com/playlist?list=PL284C9FF2488BC6D1), walked
         through the tutorial (man parallel_tutorial), and read the EXAMPLE
         section in the man page (man parallel - search for EXAMPLE:).

   Bug dependent on environment
       If you suspect the error is dependent on your environment or
       distribution, please see if you can reproduce the error on one of these
       VirtualBox images:
       https://sourceforge.net/projects/virtualboximage/files/
       https://www.osboxes.org/virtualbox-images/

       Specifying the name of your distribution is not enough as you may have
       installed software that is not in the VirtualBox images.

       If you cannot reproduce the error on any of the VirtualBox images
       above, see if you can build a VirtualBox image on which you can
       reproduce the error. If not you should assume the debugging will be
       done through you. That will put more burden on you and it is extra
       important you give any information that help. In general the problem
       will be fixed faster and with less work for you if you can reproduce
       the error on a VirtualBox.

   In summary
       Your report must include:

       o parallel --version

       o output + error message

       o full example including all files

       o VirtualBox image, if you cannot reproduce it on other systems

AUTHOR
       When using GNU parallel for a publication please cite:

       O. Tange (2011): GNU Parallel - The Command-Line Power Tool, ;login:
       The USENIX Magazine, February 2011:42-47.

       This helps funding further development; and it won't cost you a cent.
       If you pay 10000 EUR you should feel free to use GNU Parallel without
       citing.

       Copyright (C) 2007-10-18 Ole Tange, http://ole.tange.dk

       Copyright (C) 2008-2010 Ole Tange, http://ole.tange.dk

       Copyright (C) 2010-2021 Ole Tange, http://ole.tange.dk and Free
       Software Foundation, Inc.

       Parts of the manual concerning xargs compatibility is inspired by the
       manual of xargs from GNU findutils 4.4.2.

LICENSE
       This program is free software; you can redistribute it and/or modify it
       under the terms of the GNU General Public License as published by the
       Free Software Foundation; either version 3 of the License, or at your
       option any later version.

       This program is distributed in the hope that it will be useful, but
       WITHOUT ANY WARRANTY; without even the implied warranty of
       MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE.  See the GNU
       General Public License for more details.

       You should have received a copy of the GNU General Public License along
       with this program.  If not, see <https://www.gnu.org/licenses/>.

   Documentation license I
       Permission is granted to copy, distribute and/or modify this
       documentation under the terms of the GNU Free Documentation License,
       Version 1.3 or any later version published by the Free Software
       Foundation; with no Invariant Sections, with no Front-Cover Texts, and
       with no Back-Cover Texts.  A copy of the license is included in the
       file LICENSES/GFDL-1.3-or-later.txt.

   Documentation license II
       You are free:

       to Share to copy, distribute and transmit the work

       to Remix to adapt the work

       Under the following conditions:

       Attribution
                You must attribute the work in the manner specified by the
                author or licensor (but not in any way that suggests that they
                endorse you or your use of the work).

       Share Alike
                If you alter, transform, or build upon this work, you may
                distribute the resulting work only under the same, similar or
                a compatible license.

       With the understanding that:

       Waiver   Any of the above conditions can be waived if you get
                permission from the copyright holder.

       Public Domain
                Where the work or any of its elements is in the public domain
                under applicable law, that status is in no way affected by the
                license.

       Other Rights
                In no way are any of the following rights affected by the
                license:

                o Your fair dealing or fair use rights, or other applicable
                  copyright exceptions and limitations;

                o The author's moral rights;

                o Rights other persons may have either in the work itself or
                  in how the work is used, such as publicity or privacy
                  rights.

       Notice   For any reuse or distribution, you must make clear to others
                the license terms of this work.

       A copy of the full license is included in the file as
       LICENCES/CC-BY-SA-4.0.txt

DEPENDENCIES
       GNU parallel uses Perl, and the Perl modules Getopt::Long, IPC::Open3,
       Symbol, IO::File, POSIX, and File::Temp.

       For --csv it uses the Perl module Text::CSV.

       For remote usage it uses rsync with ssh.


ATTRIBUTES
       See attributes(7) for descriptions of the following attributes:


       +---------------+------------------+
       |ATTRIBUTE TYPE | ATTRIBUTE VALUE  |
       +---------------+------------------+
       |Availability   | shell/parallel   |
       +---------------+------------------+
       |Stability      | Uncommitted      |
       +---------------+------------------+

SEE ALSO
       parallel_tutorial(1), env_parallel(1), parset(1), parsort(1),
       parallel_alternatives(1), parallel_design(7), niceload(1), sql(1),
       ssh(1), ssh-agent(1), sshpass(1), ssh-copy-id(1), rsync(1)



NOTES
       Source code for open source software components in Oracle Solaris can
       be found at https://www.oracle.com/downloads/opensource/solaris-source-
       code-downloads.html.

       This software was built from source available at
       https://github.com/oracle/solaris-userland.  The original community
       source was downloaded from
       https://ftp.gnu.org/gnu/parallel/parallel-20211122.tar.bz2.

       Further information about this software can be found on the open source
       community website at https://www.gnu.org/software/parallel.



20211022                          2021-10-24                       PARALLEL(1)