マニュアルページセク ション 1: ユーザーコマンド

印刷ビューの終了

更新: 2014 年 7 月
 
 

perlretut (1)

名前

perlretut - Perl regular expressions tutorial

形式

Please see following description for synopsis

説明




Perl Programmers Reference Guide                     PERLRETUT(1)



NAME
     perlretut - Perl regular expressions tutorial

DESCRIPTION
     This page provides a basic tutorial on understanding,
     creating and using regular expressions in Perl.  It serves
     as a complement to the reference page on regular expressions
     perlre.  Regular expressions are an integral part of the
     "m//", "s///", "qr//" and "split" operators and so this
     tutorial also overlaps with "Regexp Quote-Like Operators" in
     perlop and "split" in perlfunc.

     Perl is widely renowned for excellence in text processing,
     and regular expressions are one of the big factors behind
     this fame.  Perl regular expressions display an efficiency
     and flexibility unknown in most other computer languages.
     Mastering even the basics of regular expressions will allow
     you to manipulate text with surprising ease.

     What is a regular expression?  A regular expression is
     simply a string that describes a pattern.  Patterns are in
     common use these days; examples are the patterns typed into
     a search engine to find web pages and the patterns used to
     list files in a directory, e.g., "ls *.txt" or "dir *.*".
     In Perl, the patterns described by regular expressions are
     used to search strings, extract desired parts of strings,
     and to do search and replace operations.

     Regular expressions have the undeserved reputation of being
     abstract and difficult to understand.  Regular expressions
     are constructed using simple concepts like conditionals and
     loops and are no more difficult to understand than the
     corresponding "if" conditionals and "while" loops in the
     Perl language itself.  In fact, the main challenge in
     learning regular expressions is just getting used to the
     terse notation used to express these concepts.

     This tutorial flattens the learning curve by discussing
     regular expression concepts, along with their notation, one
     at a time and with many examples.  The first part of the
     tutorial will progress from the simplest word searches to
     the basic regular expression concepts.  If you master the
     first part, you will have all the tools needed to solve
     about 98% of your needs.  The second part of the tutorial is
     for those comfortable with the basics and hungry for more
     power tools.  It discusses the more advanced regular
     expression operators and introduces the latest cutting edge
     innovations in 5.6.0.

     A note: to save time, 'regular expression' is often
     abbreviated as regexp or regex.  Regexp is a more natural
     abbreviation than regex, but is harder to pronounce.  The



perl v5.12.5         Last change: 2012-11-03                    1






Perl Programmers Reference Guide                     PERLRETUT(1)



     Perl pod documentation is evenly split on regexp vs regex;
     in Perl, there is more than one way to abbreviate it.  We'll
     use regexp in this tutorial.

Part 1: The basics
  Simple word matching
     The simplest regexp is simply a word, or more generally, a
     string of characters.  A regexp consisting of a word matches
     any string that contains that word:

         "Hello World" =~ /World/;  # matches

     What is this Perl statement all about? "Hello World" is a
     simple double quoted string.  "World" is the regular
     expression and the "//" enclosing "/World/" tells Perl to
     search a string for a match.  The operator "=~" associates
     the string with the regexp match and produces a true value
     if the regexp matched, or false if the regexp did not match.
     In our case, "World" matches the second word in "Hello
     World", so the expression is true.  Expressions like this
     are useful in conditionals:

         if ("Hello World" =~ /World/) {
             print "It matches\n";
         }
         else {
             print "It doesn't match\n";
         }

     There are useful variations on this theme.  The sense of the
     match can be reversed by using the "!~" operator:

         if ("Hello World" !~ /World/) {
             print "It doesn't match\n";
         }
         else {
             print "It matches\n";
         }

     The literal string in the regexp can be replaced by a
     variable:

         $greeting = "World";
         if ("Hello World" =~ /$greeting/) {
             print "It matches\n";
         }
         else {
             print "It doesn't match\n";
         }

     If you're matching against the special default variable $_,
     the "$_ =~" part can be omitted:



perl v5.12.5         Last change: 2012-11-03                    2






Perl Programmers Reference Guide                     PERLRETUT(1)



         $_ = "Hello World";
         if (/World/) {
             print "It matches\n";
         }
         else {
             print "It doesn't match\n";
         }

     And finally, the "//" default delimiters for a match can be
     changed to arbitrary delimiters by putting an 'm' out front:

         "Hello World" =~ m!World!;   # matches, delimited by '!'
         "Hello World" =~ m{World};   # matches, note the matching '{}'
         "/usr/bin/perl" =~ m"/perl"; # matches after '/usr/bin',
                                      # '/' becomes an ordinary char

     "/World/", "m!World!", and "m{World}" all represent the same
     thing.  When, e.g., the quote (""") is used as a delimiter,
     the forward slash '/' becomes an ordinary character and can
     be used in this regexp without trouble.

     Let's consider how different regexps would match "Hello
     World":

         "Hello World" =~ /world/;  # doesn't match
         "Hello World" =~ /o W/;    # matches
         "Hello World" =~ /oW/;     # doesn't match
         "Hello World" =~ /World /; # doesn't match

     The first regexp "world" doesn't match because regexps are
     case-sensitive.  The second regexp matches because the
     substring 'o W' occurs in the string "Hello World".  The
     space character ' ' is treated like any other character in a
     regexp and is needed to match in this case.  The lack of a
     space character is the reason the third regexp 'oW' doesn't
     match.  The fourth regexp 'World ' doesn't match because
     there is a space at the end of the regexp, but not at the
     end of the string.  The lesson here is that regexps must
     match a part of the string exactly in order for the
     statement to be true.

     If a regexp matches in more than one place in the string,
     Perl will always match at the earliest possible point in the
     string:

         "Hello World" =~ /o/;       # matches 'o' in 'Hello'
         "That hat is red" =~ /hat/; # matches 'hat' in 'That'

     With respect to character matching, there are a few more
     points you need to know about.   First of all, not all
     characters can be used 'as is' in a match.  Some characters,
     called metacharacters, are reserved for use in regexp



perl v5.12.5         Last change: 2012-11-03                    3






Perl Programmers Reference Guide                     PERLRETUT(1)



     notation.  The metacharacters are

         {}[]()^$.|*+?\

     The significance of each of these will be explained in the
     rest of the tutorial, but for now, it is important only to
     know that a metacharacter can be matched by putting a
     backslash before it:

         "2+2=4" =~ /2+2/;    # doesn't match, + is a metacharacter
         "2+2=4" =~ /2\+2/;   # matches, \+ is treated like an ordinary +
         "The interval is [0,1)." =~ /[0,1)./     # is a syntax error!
         "The interval is [0,1)." =~ /\[0,1\)\./  # matches
         "#!/usr/bin/perl" =~ /#!\/usr\/bin\/perl/;  # matches

     In the last regexp, the forward slash '/' is also
     backslashed, because it is used to delimit the regexp.  This
     can lead to LTS (leaning toothpick syndrome), however, and
     it is often more readable to change delimiters.

         "#!/usr/bin/perl" =~ m!#\!/usr/bin/perl!;  # easier to read

     The backslash character '\' is a metacharacter itself and
     needs to be backslashed:

         'C:\WIN32' =~ /C:\\WIN/;   # matches

     In addition to the metacharacters, there are some ASCII
     characters which don't have printable character equivalents
     and are instead represented by escape sequences.  Common
     examples are "\t" for a tab, "\n" for a newline, "\r" for a
     carriage return and "\a" for a bell.  If your string is
     better thought of as a sequence of arbitrary bytes, the
     octal escape sequence, e.g., "\033", or hexadecimal escape
     sequence, e.g., "\x1B" may be a more natural representation
     for your bytes.  Here are some examples of escapes:

         "1000\t2000" =~ m(0\t2)   # matches
         "1000\n2000" =~ /0\n20/   # matches
         "1000\t2000" =~ /\000\t2/ # doesn't match, "0" ne "\000"
         "cat"   =~ /\143\x61\x74/ # matches in ASCII, but a weird way to spell cat

     If you've been around Perl a while, all this talk of escape
     sequences may seem familiar.  Similar escape sequences are
     used in double-quoted strings and in fact the regexps in
     Perl are mostly treated as double-quoted strings.  This
     means that variables can be used in regexps as well.  Just
     like double-quoted strings, the values of the variables in
     the regexp will be substituted in before the regexp is
     evaluated for matching purposes.  So we have:





perl v5.12.5         Last change: 2012-11-03                    4






Perl Programmers Reference Guide                     PERLRETUT(1)



         $foo = 'house';
         'housecat' =~ /$foo/;      # matches
         'cathouse' =~ /cat$foo/;   # matches
         'housecat' =~ /${foo}cat/; # matches

     So far, so good.  With the knowledge above you can already
     perform searches with just about any literal string regexp
     you can dream up.  Here is a very simple emulation of the
     Unix grep program:

         % cat > simple_grep
         #!/usr/bin/perl
         $regexp = shift;
         while (<>) {
             print if /$regexp/;
         }
         ^D

         % chmod +x simple_grep

         % simple_grep abba /usr/dict/words
         Babbage
         cabbage
         cabbages
         sabbath
         Sabbathize
         Sabbathizes
         sabbatical
         scabbard
         scabbards

     This program is easy to understand.  "#!/usr/bin/perl" is
     the standard way to invoke a perl program from the shell.
     "$regexp = shift;" saves the first command line argument as
     the regexp to be used, leaving the rest of the command line
     arguments to be treated as files.  "while (<>)" loops over
     all the lines in all the files.  For each line,
     "print if /$regexp/;" prints the line if the regexp matches
     the line.  In this line, both "print" and "/$regexp/" use
     the default variable $_ implicitly.

     With all of the regexps above, if the regexp matched
     anywhere in the string, it was considered a match.
     Sometimes, however, we'd like to specify where in the string
     the regexp should try to match.  To do this, we would use
     the anchor metacharacters "^" and "$".  The anchor "^" means
     match at the beginning of the string and the anchor "$"
     means match at the end of the string, or before a newline at
     the end of the string.  Here is how they are used:






perl v5.12.5         Last change: 2012-11-03                    5






Perl Programmers Reference Guide                     PERLRETUT(1)



         "housekeeper" =~ /keeper/;    # matches
         "housekeeper" =~ /^keeper/;   # doesn't match
         "housekeeper" =~ /keeper$/;   # matches
         "housekeeper\n" =~ /keeper$/; # matches

     The second regexp doesn't match because "^" constrains
     "keeper" to match only at the beginning of the string, but
     "housekeeper" has keeper starting in the middle.  The third
     regexp does match, since the "$" constrains "keeper" to
     match only at the end of the string.

     When both "^" and "$" are used at the same time, the regexp
     has to match both the beginning and the end of the string,
     i.e., the regexp matches the whole string.  Consider

         "keeper" =~ /^keep$/;      # doesn't match
         "keeper" =~ /^keeper$/;    # matches
         ""       =~ /^$/;          # ^$ matches an empty string

     The first regexp doesn't match because the string has more
     to it than "keep".  Since the second regexp is exactly the
     string, it matches.  Using both "^" and "$" in a regexp
     forces the complete string to match, so it gives you
     complete control over which strings match and which don't.
     Suppose you are looking for a fellow named bert, off in a
     string by himself:

         "dogbert" =~ /bert/;   # matches, but not what you want

         "dilbert" =~ /^bert/;  # doesn't match, but ..
         "bertram" =~ /^bert/;  # matches, so still not good enough

         "bertram" =~ /^bert$/; # doesn't match, good
         "dilbert" =~ /^bert$/; # doesn't match, good
         "bert"    =~ /^bert$/; # matches, perfect

     Of course, in the case of a literal string, one could just
     as easily use the string comparison "$string eq 'bert'" and
     it would be more efficient.   The  "^...$" regexp really
     becomes useful when we add in the more powerful regexp tools
     below.

  Using character classes
     Although one can already do quite a lot with the literal
     string regexps above, we've only scratched the surface of
     regular expression technology.  In this and subsequent
     sections we will introduce regexp concepts (and associated
     metacharacter notations) that will allow a regexp to not
     just represent a single character sequence, but a whole
     class of them.





perl v5.12.5         Last change: 2012-11-03                    6






Perl Programmers Reference Guide                     PERLRETUT(1)



     One such concept is that of a character class.  A character
     class allows a set of possible characters, rather than just
     a single character, to match at a particular point in a
     regexp.  Character classes are denoted by brackets "[...]",
     with the set of characters to be possibly matched inside.
     Here are some examples:

         /cat/;       # matches 'cat'
         /[bcr]at/;   # matches 'bat, 'cat', or 'rat'
         /item[0123456789]/;  # matches 'item0' or ... or 'item9'
         "abc" =~ /[cab]/;    # matches 'a'

     In the last statement, even though 'c' is the first
     character in the class, 'a' matches because the first
     character position in the string is the earliest point at
     which the regexp can match.

         /[yY][eE][sS]/;      # match 'yes' in a case-insensitive way
                              # 'yes', 'Yes', 'YES', etc.

     This regexp displays a common task: perform a case-
     insensitive match.  Perl provides a way of avoiding all
     those brackets by simply appending an 'i' to the end of the
     match.  Then "/[yY][eE][sS]/;" can be rewritten as
     "/yes/i;".  The 'i' stands for case-insensitive and is an
     example of a modifier of the matching operation.  We will
     meet other modifiers later in the tutorial.

     We saw in the section above that there were ordinary
     characters, which represented themselves, and special
     characters, which needed a backslash "\" to represent
     themselves.  The same is true in a character class, but the
     sets of ordinary and special characters inside a character
     class are different than those outside a character class.
     The special characters for a character class are "-]\^$"
     (and the pattern delimiter, whatever it is).  "]" is special
     because it denotes the end of a character class.  "$" is
     special because it denotes a scalar variable.  "\" is
     special because it is used in escape sequences, just like
     above.  Here is how the special characters "]$\" are
     handled:

        /[\]c]def/; # matches ']def' or 'cdef'
        $x = 'bcr';
        /[$x]at/;   # matches 'bat', 'cat', or 'rat'
        /[\$x]at/;  # matches '$at' or 'xat'
        /[\\$x]at/; # matches '\at', 'bat, 'cat', or 'rat'

     The last two are a little tricky.  In "[\$x]", the backslash
     protects the dollar sign, so the character class has two
     members "$" and "x".  In "[\\$x]", the backslash is
     protected, so $x is treated as a variable and substituted in



perl v5.12.5         Last change: 2012-11-03                    7






Perl Programmers Reference Guide                     PERLRETUT(1)



     double quote fashion.

     The special character '-' acts as a range operator within
     character classes, so that a contiguous set of characters
     can be written as a range.  With ranges, the unwieldy
     "[0123456789]" and "[abc...xyz]" become the svelte "[0-9]"
     and "[a-z]".  Some examples are

         /item[0-9]/;  # matches 'item0' or ... or 'item9'
         /[0-9bx-z]aa/;  # matches '0aa', ..., '9aa',
                         # 'baa', 'xaa', 'yaa', or 'zaa'
         /[0-9a-fA-F]/;  # matches a hexadecimal digit
         /[0-9a-zA-Z_]/; # matches a "word" character,
                         # like those in a Perl variable name

     If '-' is the first or last character in a character class,
     it is treated as an ordinary character; "[-ab]", "[ab-]" and
     "[a\-b]" are all equivalent.

     The special character "^" in the first position of a
     character class denotes a negated character class, which
     matches any character but those in the brackets.  Both
     "[...]" and "[^...]" must match a character, or the match
     fails.  Then

         /[^a]at/;  # doesn't match 'aat' or 'at', but matches
                    # all other 'bat', 'cat, '0at', '%at', etc.
         /[^0-9]/;  # matches a non-numeric character
         /[a^]at/;  # matches 'aat' or '^at'; here '^' is ordinary

     Now, even "[0-9]" can be a bother to write multiple times,
     so in the interest of saving keystrokes and making regexps
     more readable, Perl has several abbreviations for common
     character classes, as shown below.  Since the introduction
     of Unicode, these character classes match more than just a
     few characters in the ISO 8859-1 range.

     o   \d matches a digit, not just [0-9] but also digits from
         non-roman scripts

     o   \s matches a whitespace character, the set [\ \t\r\n\f]
         and others

     o   \w matches a word character (alphanumeric or _), not
         just [0-9a-zA-Z_] but also digits and characters from
         non-roman scripts

     o   \D is a negated \d; it represents any other character
         than a digit, or [^\d]

     o   \S is a negated \s; it represents any non-whitespace
         character [^\s]



perl v5.12.5         Last change: 2012-11-03                    8






Perl Programmers Reference Guide                     PERLRETUT(1)



     o   \W is a negated \w; it represents any non-word character
         [^\w]

     o   The period '.' matches any character but "\n" (unless
         the modifier "//s" is in effect, as explained below).

     The "\d\s\w\D\S\W" abbreviations can be used both inside and
     outside of character classes.  Here are some in use:

         /\d\d:\d\d:\d\d/; # matches a hh:mm:ss time format
         /[\d\s]/;         # matches any digit or whitespace character
         /\w\W\w/;         # matches a word char, followed by a
                           # non-word char, followed by a word char
         /..rt/;           # matches any two chars, followed by 'rt'
         /end\./;          # matches 'end.'
         /end[.]/;         # same thing, matches 'end.'

     Because a period is a metacharacter, it needs to be escaped
     to match as an ordinary period. Because, for example, "\d"
     and "\w" are sets of characters, it is incorrect to think of
     "[^\d\w]" as "[\D\W]"; in fact "[^\d\w]" is the same as
     "[^\w]", which is the same as "[\W]". Think DeMorgan's laws.

     An anchor useful in basic regexps is the word anchor "\b".
     This matches a boundary between a word character and a non-
     word character "\w\W" or "\W\w":

         $x = "Housecat catenates house and cat";
         $x =~ /cat/;    # matches cat in 'housecat'
         $x =~ /\bcat/;  # matches cat in 'catenates'
         $x =~ /cat\b/;  # matches cat in 'housecat'
         $x =~ /\bcat\b/;  # matches 'cat' at end of string

     Note in the last example, the end of the string is
     considered a word boundary.

     You might wonder why '.' matches everything but "\n" - why
     not every character? The reason is that often one is
     matching against lines and would like to ignore the newline
     characters.  For instance, while the string "\n" represents
     one line, we would like to think of it as empty.  Then

         ""   =~ /^$/;    # matches
         "\n" =~ /^$/;    # matches, $ anchors before "\n"

         ""   =~ /./;      # doesn't match; it needs a char
         ""   =~ /^.$/;    # doesn't match; it needs a char
         "\n" =~ /^.$/;    # doesn't match; it needs a char other than "\n"
         "a"  =~ /^.$/;    # matches
         "a\n"  =~ /^.$/;  # matches, $ anchors before "\n"





perl v5.12.5         Last change: 2012-11-03                    9






Perl Programmers Reference Guide                     PERLRETUT(1)



     This behavior is convenient, because we usually want to
     ignore newlines when we count and match characters in a
     line.  Sometimes, however, we want to keep track of
     newlines.  We might even want "^" and "$" to anchor at the
     beginning and end of lines within the string, rather than
     just the beginning and end of the string.  Perl allows us to
     choose between ignoring and paying attention to newlines by
     using the "//s" and "//m" modifiers.  "//s" and "//m" stand
     for single line and multi-line and they determine whether a
     string is to be treated as one continuous string, or as a
     set of lines.  The two modifiers affect two aspects of how
     the regexp is interpreted: 1) how the '.' character class is
     defined, and 2) where the anchors "^" and "$" are able to
     match.  Here are the four possible combinations:

     o   no modifiers (//): Default behavior.  '.' matches any
         character except "\n".  "^" matches only at the
         beginning of the string and "$" matches only at the end
         or before a newline at the end.

     o   s modifier (//s): Treat string as a single long line.
         '.' matches any character, even "\n".  "^" matches only
         at the beginning of the string and "$" matches only at
         the end or before a newline at the end.

     o   m modifier (//m): Treat string as a set of multiple
         lines.  '.' matches any character except "\n".  "^" and
         "$" are able to match at the start or end of any line
         within the string.

     o   both s and m modifiers (//sm): Treat string as a single
         long line, but detect multiple lines.  '.' matches any
         character, even "\n".  "^" and "$", however, are able to
         match at the start or end of any line within the string.

     Here are examples of "//s" and "//m" in action:

         $x = "There once was a girl\nWho programmed in Perl\n";

         $x =~ /^Who/;   # doesn't match, "Who" not at start of string
         $x =~ /^Who/s;  # doesn't match, "Who" not at start of string
         $x =~ /^Who/m;  # matches, "Who" at start of second line
         $x =~ /^Who/sm; # matches, "Who" at start of second line

         $x =~ /girl.Who/;   # doesn't match, "." doesn't match "\n"
         $x =~ /girl.Who/s;  # matches, "." matches "\n"
         $x =~ /girl.Who/m;  # doesn't match, "." doesn't match "\n"
         $x =~ /girl.Who/sm; # matches, "." matches "\n"

     Most of the time, the default behavior is what is wanted,
     but "//s" and "//m" are occasionally very useful.  If "//m"
     is being used, the start of the string can still be matched



perl v5.12.5         Last change: 2012-11-03                   10






Perl Programmers Reference Guide                     PERLRETUT(1)



     with "\A" and the end of the string can still be matched
     with the anchors "\Z" (matches both the end and the newline
     before, like "$"), and "\z" (matches only the end):

         $x =~ /^Who/m;   # matches, "Who" at start of second line
         $x =~ /\AWho/m;  # doesn't match, "Who" is not at start of string

         $x =~ /girl$/m;  # matches, "girl" at end of first line
         $x =~ /girl\Z/m; # doesn't match, "girl" is not at end of string

         $x =~ /Perl\Z/m; # matches, "Perl" is at newline before end
         $x =~ /Perl\z/m; # doesn't match, "Perl" is not at end of string

     We now know how to create choices among classes of
     characters in a regexp.  What about choices among words or
     character strings? Such choices are described in the next
     section.

  Matching this or that
     Sometimes we would like our regexp to be able to match
     different possible words or character strings.  This is
     accomplished by using the alternation metacharacter "|".  To
     match "dog" or "cat", we form the regexp "dog|cat".  As
     before, Perl will try to match the regexp at the earliest
     possible point in the string.  At each character position,
     Perl will first try to match the first alternative, "dog".
     If "dog" doesn't match, Perl will then try the next
     alternative, "cat".  If "cat" doesn't match either, then the
     match fails and Perl moves to the next position in the
     string.  Some examples:

         "cats and dogs" =~ /cat|dog|bird/;  # matches "cat"
         "cats and dogs" =~ /dog|cat|bird/;  # matches "cat"

     Even though "dog" is the first alternative in the second
     regexp, "cat" is able to match earlier in the string.

         "cats"          =~ /c|ca|cat|cats/; # matches "c"
         "cats"          =~ /cats|cat|ca|c/; # matches "cats"

     Here, all the alternatives match at the first string
     position, so the first alternative is the one that matches.
     If some of the alternatives are truncations of the others,
     put the longest ones first to give them a chance to match.

         "cab" =~ /a|b|c/ # matches "c"
                          # /a|b|c/ == /[abc]/

     The last example points out that character classes are like
     alternations of characters.  At a given character position,
     the first alternative that allows the regexp match to
     succeed will be the one that matches.



perl v5.12.5         Last change: 2012-11-03                   11






Perl Programmers Reference Guide                     PERLRETUT(1)



  Grouping things and hierarchical matching
     Alternation allows a regexp to choose among alternatives,
     but by itself it is unsatisfying.  The reason is that each
     alternative is a whole regexp, but sometime we want
     alternatives for just part of a regexp.  For instance,
     suppose we want to search for housecats or housekeepers.
     The regexp "housecat|housekeeper" fits the bill, but is
     inefficient because we had to type "house" twice.  It would
     be nice to have parts of the regexp be constant, like
     "house", and some parts have alternatives, like
     "cat|keeper".

     The grouping metacharacters "()" solve this problem.
     Grouping allows parts of a regexp to be treated as a single
     unit.  Parts of a regexp are grouped by enclosing them in
     parentheses.  Thus we could solve the "housecat|housekeeper"
     by forming the regexp as "house(cat|keeper)".  The regexp
     "house(cat|keeper)" means match "house" followed by either
     "cat" or "keeper".  Some more examples are

         /(a|b)b/;    # matches 'ab' or 'bb'
         /(ac|b)b/;   # matches 'acb' or 'bb'
         /(^a|b)c/;   # matches 'ac' at start of string or 'bc' anywhere
         /(a|[bc])d/; # matches 'ad', 'bd', or 'cd'

         /house(cat|)/;  # matches either 'housecat' or 'house'
         /house(cat(s|)|)/;  # matches either 'housecats' or 'housecat' or
                             # 'house'.  Note groups can be nested.

         /(19|20|)\d\d/;  # match years 19xx, 20xx, or the Y2K problem, xx
         "20" =~ /(19|20|)\d\d/;  # matches the null alternative '()\d\d',
                                  # because '20\d\d' can't match

     Alternations behave the same way in groups as out of them:
     at a given string position, the leftmost alternative that
     allows the regexp to match is taken.  So in the last example
     at the first string position, "20" matches the second
     alternative, but there is nothing left over to match the
     next two digits "\d\d".  So Perl moves on to the next
     alternative, which is the null alternative and that works,
     since "20" is two digits.

     The process of trying one alternative, seeing if it matches,
     and moving on to the next alternative, while going back in
     the string from where the previous alternative was tried, if
     it doesn't, is called backtracking.  The term 'backtracking'
     comes from the idea that matching a regexp is like a walk in
     the woods.  Successfully matching a regexp is like arriving
     at a destination.  There are many possible trailheads, one
     for each string position, and each one is tried in order,
     left to right.  From each trailhead there may be many paths,
     some of which get you there, and some which are dead ends.



perl v5.12.5         Last change: 2012-11-03                   12






Perl Programmers Reference Guide                     PERLRETUT(1)



     When you walk along a trail and hit a dead end, you have to
     backtrack along the trail to an earlier point to try another
     trail.  If you hit your destination, you stop immediately
     and forget about trying all the other trails.  You are
     persistent, and only if you have tried all the trails from
     all the trailheads and not arrived at your destination, do
     you declare failure.  To be concrete, here is a step-by-step
     analysis of what Perl does when it tries to match the regexp

         "abcde" =~ /(abd|abc)(df|d|de)/;

     0   Start with the first letter in the string 'a'.

     1   Try the first alternative in the first group 'abd'.

     2   Match 'a' followed by 'b'. So far so good.

     3   'd' in the regexp doesn't match 'c' in the string - a
         dead end.  So backtrack two characters and pick the
         second alternative in the first group 'abc'.

     4   Match 'a' followed by 'b' followed by 'c'.  We are on a
         roll and have satisfied the first group. Set $1 to
         'abc'.

     5   Move on to the second group and pick the first
         alternative 'df'.

     6   Match the 'd'.

     7   'f' in the regexp doesn't match 'e' in the string, so a
         dead end.  Backtrack one character and pick the second
         alternative in the second group 'd'.

     8   'd' matches. The second grouping is satisfied, so set $2
         to 'd'.

     9   We are at the end of the regexp, so we are done! We have
         matched 'abcd' out of the string "abcde".

     There are a couple of things to note about this analysis.
     First, the third alternative in the second group 'de' also
     allows a match, but we stopped before we got to it - at a
     given character position, leftmost wins.  Second, we were
     able to get a match at the first character position of the
     string 'a'.  If there were no matches at the first position,
     Perl would move to the second character position 'b' and
     attempt the match all over again.  Only when all possible
     paths at all possible character positions have been
     exhausted does Perl give up and declare
     "$string =~ /(abd|abc)(df|d|de)/;" to be false.




perl v5.12.5         Last change: 2012-11-03                   13






Perl Programmers Reference Guide                     PERLRETUT(1)



     Even with all this work, regexp matching happens remarkably
     fast.  To speed things up, Perl compiles the regexp into a
     compact sequence of opcodes that can often fit inside a
     processor cache.  When the code is executed, these opcodes
     can then run at full throttle and search very quickly.

  Extracting matches
     The grouping metacharacters "()" also serve another
     completely different function: they allow the extraction of
     the parts of a string that matched.  This is very useful to
     find out what matched and for text processing in general.
     For each grouping, the part that matched inside goes into
     the special variables $1, $2, etc.  They can be used just as
     ordinary variables:

         # extract hours, minutes, seconds
         if ($time =~ /(\d\d):(\d\d):(\d\d)/) {    # match hh:mm:ss format
             $hours = $1;
             $minutes = $2;
             $seconds = $3;
         }

     Now, we know that in scalar context,
     "$time =~ /(\d\d):(\d\d):(\d\d)/" returns a true or false
     value.  In list context, however, it returns the list of
     matched values "($1,$2,$3)".  So we could write the code
     more compactly as

         # extract hours, minutes, seconds
         ($hours, $minutes, $second) = ($time =~ /(\d\d):(\d\d):(\d\d)/);

     If the groupings in a regexp are nested, $1 gets the group
     with the leftmost opening parenthesis, $2 the next opening
     parenthesis, etc.  Here is a regexp with nested groups:

         /(ab(cd|ef)((gi)|j))/;
          1  2      34

     If this regexp matches, $1 contains a string starting with
     'ab', $2 is either set to 'cd' or 'ef', $3 equals either
     'gi' or 'j', and $4 is either set to 'gi', just like $3, or
     it remains undefined.

     For convenience, Perl sets $+ to the string held by the
     highest numbered $1, $2,... that got assigned (and, somewhat
     related, $^N to the value of the $1, $2,... most-recently
     assigned; i.e. the $1, $2,... associated with the rightmost
     closing parenthesis used in the match).

  Backreferences
     Closely associated with the matching variables $1, $2, ...
     are the backreferences "\1", "\2",...  Backreferences are



perl v5.12.5         Last change: 2012-11-03                   14






Perl Programmers Reference Guide                     PERLRETUT(1)



     simply matching variables that can be used inside a regexp.
     This is a really nice feature; what matches later in a
     regexp is made to depend on what matched earlier in the
     regexp.  Suppose we wanted to look for doubled words in a
     text, like 'the the'.  The following regexp finds all
     3-letter doubles with a space in between:

         /\b(\w\w\w)\s\1\b/;

     The grouping assigns a value to \1, so that the same 3
     letter sequence is used for both parts.

     A similar task is to find words consisting of two identical
     parts:

         % simple_grep '^(\w\w\w\w|\w\w\w|\w\w|\w)\1$' /usr/dict/words
         beriberi
         booboo
         coco
         mama
         murmur
         papa

     The regexp has a single grouping which considers 4-letter
     combinations, then 3-letter combinations, etc., and uses
     "\1" to look for a repeat.  Although $1 and "\1" represent
     the same thing, care should be taken to use matched
     variables $1, $2,... only outside a regexp and
     backreferences "\1", "\2",... only inside a regexp; not
     doing so may lead to surprising and unsatisfactory results.

  Relative backreferences
     Counting the opening parentheses to get the correct number
     for a backreference is errorprone as soon as there is more
     than one capturing group.  A more convenient technique
     became available with Perl 5.10: relative backreferences. To
     refer to the immediately preceding capture group one now may
     write "\g{-1}", the next but last is available via "\g{-2}",
     and so on.

     Another good reason in addition to readability and
     maintainability for using relative backreferences  is
     illustrated by the following example, where a simple pattern
     for matching peculiar strings is used:

         $a99a = '([a-z])(\d)\2\1';   # matches a11a, g22g, x33x, etc.

     Now that we have this pattern stored as a handy string, we
     might feel tempted to use it as a part of some other
     pattern:





perl v5.12.5         Last change: 2012-11-03                   15






Perl Programmers Reference Guide                     PERLRETUT(1)



         $line = "code=e99e";
         if ($line =~ /^(\w+)=$a99a$/){   # unexpected behavior!
             print "$1 is valid\n";
         } else {
             print "bad line: '$line'\n";
         }

     But this doesn't match, at least not the way one might
     expect. Only after inserting the interpolated $a99a and
     looking at the resulting full text of the regexp is it
     obvious that the backreferences have backfired. The
     subexpression "(\w+)" has snatched number 1 and demoted the
     groups in $a99a by one rank. This can be avoided by using
     relative backreferences:

         $a99a = '([a-z])(\d)\g{-1}\g{-2}';  # safe for being interpolated

  Named backreferences
     Perl 5.10 also introduced named capture buffers and named
     backreferences.  To attach a name to a capturing group, you
     write either "(?<name>...)" or "(?'name'...)".  The
     backreference may then be written as "\g{name}".  It is
     permissible to attach the same name to more than one group,
     but then only the leftmost one of the eponymous set can be
     referenced.  Outside of the pattern a named capture buffer
     is accessible through the "%+" hash.

     Assuming that we have to match calendar dates which may be
     given in one of the three formats yyyy-mm-dd, mm/dd/yyyy or
     dd.mm.yyyy, we can write three suitable patterns where we
     use 'd', 'm' and 'y' respectively as the names of the
     buffers capturing the pertaining components of a date. The
     matching operation combines the three patterns as
     alternatives:

         $fmt1 = '(?<y>\d\d\d\d)-(?<m>\d\d)-(?<d>\d\d)';
         $fmt2 = '(?<m>\d\d)/(?<d>\d\d)/(?<y>\d\d\d\d)';
         $fmt3 = '(?<d>\d\d)\.(?<m>\d\d)\.(?<y>\d\d\d\d)';
         for my $d qw( 2006-10-21 15.01.2007 10/31/2005 ){
             if ( $d =~ m{$fmt1|$fmt2|$fmt3} ){
                 print "day=$+{d} month=$+{m} year=$+{y}\n";
             }
         }

     If any of the alternatives matches, the hash "%+" is bound
     to contain the three key-value pairs.

  Alternative capture group numbering
     Yet another capturing group numbering technique (also as
     from Perl 5.10) deals with the problem of referring to
     groups within a set of alternatives.  Consider a pattern for
     matching a time of the day, civil or military style:



perl v5.12.5         Last change: 2012-11-03                   16






Perl Programmers Reference Guide                     PERLRETUT(1)



         if ( $time =~ /(\d\d|\d):(\d\d)|(\d\d)(\d\d)/ ){
             # process hour and minute
         }

     Processing the results requires an additional if statement
     to determine whether $1 and $2 or $3 and $4 contain the
     goodies. It would be easier if we could use buffer numbers 1
     and 2 in second alternative as well, and this is exactly
     what the parenthesized construct "(?|...)", set around an
     alternative achieves. Here is an extended version of the
     previous pattern:

         if ( $time =~ /(?|(\d\d|\d):(\d\d)|(\d\d)(\d\d))\s+([A-Z][A-Z][A-Z])/ ){
             print "hour=$1 minute=$2 zone=$3\n";
         }

     Within the alternative numbering group, buffer numbers start
     at the same position for each alternative. After the group,
     numbering continues with one higher than the maximum reached
     across all the alternatives.

  Position information
     In addition to what was matched, Perl (since 5.6.0) also
     provides the positions of what was matched as contents of
     the "@-" and "@+" arrays. "$-[0]" is the position of the
     start of the entire match and $+[0] is the position of the
     end. Similarly, "$-[n]" is the position of the start of the
     $n match and $+[n] is the position of the end. If $n is
     undefined, so are "$-[n]" and $+[n]. Then this code

         $x = "Mmm...donut, thought Homer";
         $x =~ /^(Mmm|Yech)\.\.\.(donut|peas)/; # matches
         foreach $expr (1..$#-) {
             print "Match $expr: '${$expr}' at position ($-[$expr],$+[$expr])\n";
         }

     prints

         Match 1: 'Mmm' at position (0,3)
         Match 2: 'donut' at position (6,11)

     Even if there are no groupings in a regexp, it is still
     possible to find out what exactly matched in a string.  If
     you use them, Perl will set "$`" to the part of the string
     before the match, will set $& to the part of the string that
     matched, and will set "$'" to the part of the string after
     the match.  An example:

         $x = "the cat caught the mouse";
         $x =~ /cat/;  # $` = 'the ', $& = 'cat', $' = ' caught the mouse'
         $x =~ /the/;  # $` = '', $& = 'the', $' = ' cat caught the mouse'




perl v5.12.5         Last change: 2012-11-03                   17






Perl Programmers Reference Guide                     PERLRETUT(1)



     In the second match, "$`" equals '' because the regexp
     matched at the first character position in the string and
     stopped; it never saw the second 'the'.  It is important to
     note that using "$`" and "$'" slows down regexp matching
     quite a bit, while $& slows it down to a lesser extent,
     because if they are used in one regexp in a program, they
     are generated for all regexps in the program.  So if raw
     performance is a goal of your application, they should be
     avoided.  If you need to extract the corresponding
     substrings, use "@-" and "@+" instead:

         $` is the same as substr( $x, 0, $-[0] )
         $& is the same as substr( $x, $-[0], $+[0]-$-[0] )
         $' is the same as substr( $x, $+[0] )

  Non-capturing groupings
     A group that is required to bundle a set of alternatives may
     or may not be useful as a capturing group.  If it isn't, it
     just creates a superfluous addition to the set of available
     capture buffer values, inside as well as outside the regexp.
     Non-capturing groupings, denoted by "(?:regexp)", still
     allow the regexp to be treated as a single unit, but don't
     establish a capturing buffer at the same time.  Both
     capturing and non-capturing groupings are allowed to co-
     exist in the same regexp.  Because there is no extraction,
     non-capturing groupings are faster than capturing groupings.
     Non-capturing groupings are also handy for choosing exactly
     which parts of a regexp are to be extracted to matching
     variables:

         # match a number, $1-$4 are set, but we only want $1
         /([+-]?\ *(\d+(\.\d*)?|\.\d+)([eE][+-]?\d+)?)/;

         # match a number faster , only $1 is set
         /([+-]?\ *(?:\d+(?:\.\d*)?|\.\d+)(?:[eE][+-]?\d+)?)/;

         # match a number, get $1 = whole number, $2 = exponent
         /([+-]?\ *(?:\d+(?:\.\d*)?|\.\d+)(?:[eE]([+-]?\d+))?)/;

     Non-capturing groupings are also useful for removing
     nuisance elements gathered from a split operation where
     parentheses are required for some reason:

         $x = '12aba34ba5';
         @num = split /(a|b)+/, $x;    # @num = ('12','a','34','b','5')
         @num = split /(?:a|b)+/, $x;  # @num = ('12','34','5')

  Matching repetitions
     The examples in the previous section display an annoying
     weakness.  We were only matching 3-letter words, or chunks
     of words of 4 letters or less.  We'd like to be able to
     match words or, more generally, strings of any length,



perl v5.12.5         Last change: 2012-11-03                   18






Perl Programmers Reference Guide                     PERLRETUT(1)



     without writing out tedious alternatives like
     "\w\w\w\w|\w\w\w|\w\w|\w".

     This is exactly the problem the quantifier metacharacters
     "?", "*", "+", and "{}" were created for.  They allow us to
     delimit the number of repeats for a portion of a regexp we
     consider to be a match.  Quantifiers are put immediately
     after the character, character class, or grouping that we
     want to specify.  They have the following meanings:

     o   "a?" means: match 'a' 1 or 0 times

     o   "a*" means: match 'a' 0 or more times, i.e., any number
         of times

     o   "a+" means: match 'a' 1 or more times, i.e., at least
         once

     o   "a{n,m}" means: match at least "n" times, but not more
         than "m" times.

     o   "a{n,}" means: match at least "n" or more times

     o   "a{n}" means: match exactly "n" times

     Here are some examples:

         /[a-z]+\s+\d*/;  # match a lowercase word, at least one space, and
                          # any number of digits
         /(\w+)\s+\1/;    # match doubled words of arbitrary length
         /y(es)?/i;       # matches 'y', 'Y', or a case-insensitive 'yes'
         $year =~ /\d{2,4}/;  # make sure year is at least 2 but not more
                              # than 4 digits
         $year =~ /\d{4}|\d{2}/;    # better match; throw out 3 digit dates
         $year =~ /\d{2}(\d{2})?/;  # same thing written differently. However,
                                    # this produces $1 and the other does not.

         % simple_grep '^(\w+)\1$' /usr/dict/words   # isn't this easier?
         beriberi
         booboo
         coco
         mama
         murmur
         papa

     For all of these quantifiers, Perl will try to match as much
     of the string as possible, while still allowing the regexp
     to succeed.  Thus with "/a?.../", Perl will first try to
     match the regexp with the "a" present; if that fails, Perl
     will try to match the regexp without the "a" present.  For
     the quantifier "*", we get the following:




perl v5.12.5         Last change: 2012-11-03                   19






Perl Programmers Reference Guide                     PERLRETUT(1)



         $x = "the cat in the hat";
         $x =~ /^(.*)(cat)(.*)$/; # matches,
                                  # $1 = 'the '
                                  # $2 = 'cat'
                                  # $3 = ' in the hat'

     Which is what we might expect, the match finds the only
     "cat" in the string and locks onto it.  Consider, however,
     this regexp:

         $x =~ /^(.*)(at)(.*)$/; # matches,
                                 # $1 = 'the cat in the h'
                                 # $2 = 'at'
                                 # $3 = ''   (0 characters match)

     One might initially guess that Perl would find the "at" in
     "cat" and stop there, but that wouldn't give the longest
     possible string to the first quantifier ".*".  Instead, the
     first quantifier ".*" grabs as much of the string as
     possible while still having the regexp match.  In this
     example, that means having the "at" sequence with the final
     "at" in the string.  The other important principle
     illustrated here is that when there are two or more elements
     in a regexp, the leftmost quantifier, if there is one, gets
     to grab as much the string as possible, leaving the rest of
     the regexp to fight over scraps.  Thus in our example, the
     first quantifier ".*" grabs most of the string, while the
     second quantifier ".*" gets the empty string.   Quantifiers
     that grab as much of the string as possible are called
     maximal match or greedy quantifiers.

     When a regexp can match a string in several different ways,
     we can use the principles above to predict which way the
     regexp will match:

     o   Principle 0: Taken as a whole, any regexp will be
         matched at the earliest possible position in the string.

     o   Principle 1: In an alternation "a|b|c...", the leftmost
         alternative that allows a match for the whole regexp
         will be the one used.

     o   Principle 2: The maximal matching quantifiers "?", "*",
         "+" and "{n,m}" will in general match as much of the
         string as possible while still allowing the whole regexp
         to match.

     o   Principle 3: If there are two or more elements in a
         regexp, the leftmost greedy quantifier, if any, will
         match as much of the string as possible while still
         allowing the whole regexp to match.  The next leftmost
         greedy quantifier, if any, will try to match as much of



perl v5.12.5         Last change: 2012-11-03                   20






Perl Programmers Reference Guide                     PERLRETUT(1)



         the string remaining available to it as possible, while
         still allowing the whole regexp to match.  And so on,
         until all the regexp elements are satisfied.

     As we have seen above, Principle 0 overrides the others. The
     regexp will be matched as early as possible, with the other
     principles determining how the regexp matches at that
     earliest character position.

     Here is an example of these principles in action:

         $x = "The programming republic of Perl";
         $x =~ /^(.+)(e|r)(.*)$/;  # matches,
                                   # $1 = 'The programming republic of Pe'
                                   # $2 = 'r'
                                   # $3 = 'l'

     This regexp matches at the earliest string position, 'T'.
     One might think that "e", being leftmost in the alternation,
     would be matched, but "r" produces the longest string in the
     first quantifier.

         $x =~ /(m{1,2})(.*)$/;  # matches,
                                 # $1 = 'mm'
                                 # $2 = 'ing republic of Perl'

     Here, The earliest possible match is at the first 'm' in
     "programming". "m{1,2}" is the first quantifier, so it gets
     to match a maximal "mm".

         $x =~ /.*(m{1,2})(.*)$/;  # matches,
                                   # $1 = 'm'
                                   # $2 = 'ing republic of Perl'

     Here, the regexp matches at the start of the string. The
     first quantifier ".*" grabs as much as possible, leaving
     just a single 'm' for the second quantifier "m{1,2}".

         $x =~ /(.?)(m{1,2})(.*)$/;  # matches,
                                     # $1 = 'a'
                                     # $2 = 'mm'
                                     # $3 = 'ing republic of Perl'

     Here, ".?" eats its maximal one character at the earliest
     possible position in the string, 'a' in "programming",
     leaving "m{1,2}" the opportunity to match both "m"'s.
     Finally,

         "aXXXb" =~ /(X*)/; # matches with $1 = ''

     because it can match zero copies of 'X' at the beginning of
     the string.  If you definitely want to match at least one



perl v5.12.5         Last change: 2012-11-03                   21






Perl Programmers Reference Guide                     PERLRETUT(1)



     'X', use "X+", not "X*".

     Sometimes greed is not good.  At times, we would like
     quantifiers to match a minimal piece of string, rather than
     a maximal piece.  For this purpose, Larry Wall created the
     minimal match or non-greedy quantifiers "??", "*?", "+?",
     and "{}?".  These are the usual quantifiers with a "?"
     appended to them.  They have the following meanings:

     o   "a??" means: match 'a' 0 or 1 times. Try 0 first, then
         1.

     o   "a*?" means: match 'a' 0 or more times, i.e., any number
         of times, but as few times as possible

     o   "a+?" means: match 'a' 1 or more times, i.e., at least
         once, but as few times as possible

     o   "a{n,m}?" means: match at least "n" times, not more than
         "m" times, as few times as possible

     o   "a{n,}?" means: match at least "n" times, but as few
         times as possible

     o   "a{n}?" means: match exactly "n" times.  Because we
         match exactly "n" times, "a{n}?" is equivalent to "a{n}"
         and is just there for notational consistency.

     Let's look at the example above, but with minimal
     quantifiers:

         $x = "The programming republic of Perl";
         $x =~ /^(.+?)(e|r)(.*)$/; # matches,
                                   # $1 = 'Th'
                                   # $2 = 'e'
                                   # $3 = ' programming republic of Perl'

     The minimal string that will allow both the start of the
     string "^" and the alternation to match is "Th", with the
     alternation "e|r" matching "e".  The second quantifier ".*"
     is free to gobble up the rest of the string.

         $x =~ /(m{1,2}?)(.*?)$/;  # matches,
                                   # $1 = 'm'
                                   # $2 = 'ming republic of Perl'

     The first string position that this regexp can match is at
     the first 'm' in "programming". At this position, the
     minimal "m{1,2}?"  matches just one 'm'.  Although the
     second quantifier ".*?" would prefer to match no characters,
     it is constrained by the end-of-string anchor "$" to match
     the rest of the string.



perl v5.12.5         Last change: 2012-11-03                   22






Perl Programmers Reference Guide                     PERLRETUT(1)



         $x =~ /(.*?)(m{1,2}?)(.*)$/;  # matches,
                                       # $1 = 'The progra'
                                       # $2 = 'm'
                                       # $3 = 'ming republic of Perl'

     In this regexp, you might expect the first minimal
     quantifier ".*?"  to match the empty string, because it is
     not constrained by a "^" anchor to match the beginning of
     the word.  Principle 0 applies here, however.  Because it is
     possible for the whole regexp to match at the start of the
     string, it will match at the start of the string.  Thus the
     first quantifier has to match everything up to the first
     "m".  The second minimal quantifier matches just one "m" and
     the third quantifier matches the rest of the string.

         $x =~ /(.??)(m{1,2})(.*)$/;  # matches,
                                      # $1 = 'a'
                                      # $2 = 'mm'
                                      # $3 = 'ing republic of Perl'

     Just as in the previous regexp, the first quantifier ".??"
     can match earliest at position 'a', so it does.  The second
     quantifier is greedy, so it matches "mm", and the third
     matches the rest of the string.

     We can modify principle 3 above to take into account non-
     greedy quantifiers:

     o   Principle 3: If there are two or more elements in a
         regexp, the leftmost greedy (non-greedy) quantifier, if
         any, will match as much (little) of the string as
         possible while still allowing the whole regexp to match.
         The next leftmost greedy (non-greedy) quantifier, if
         any, will try to match as much (little) of the string
         remaining available to it as possible, while still
         allowing the whole regexp to match.  And so on, until
         all the regexp elements are satisfied.

     Just like alternation, quantifiers are also susceptible to
     backtracking.  Here is a step-by-step analysis of the
     example

         $x = "the cat in the hat";
         $x =~ /^(.*)(at)(.*)$/; # matches,
                                 # $1 = 'the cat in the h'
                                 # $2 = 'at'
                                 # $3 = ''   (0 matches)

     0   Start with the first letter in the string 't'.

     1   The first quantifier '.*' starts out by matching the
         whole string 'the cat in the hat'.



perl v5.12.5         Last change: 2012-11-03                   23






Perl Programmers Reference Guide                     PERLRETUT(1)



     2   'a' in the regexp element 'at' doesn't match the end of
         the string.  Backtrack one character.

     3   'a' in the regexp element 'at' still doesn't match the
         last letter of the string 't', so backtrack one more
         character.

     4   Now we can match the 'a' and the 't'.

     5   Move on to the third element '.*'.  Since we are at the
         end of the string and '.*' can match 0 times, assign it
         the empty string.

     6   We are done!

     Most of the time, all this moving forward and backtracking
     happens quickly and searching is fast. There are some
     pathological regexps, however, whose execution time
     exponentially grows with the size of the string.  A typical
     structure that blows up in your face is of the form

         /(a|b+)*/;

     The problem is the nested indeterminate quantifiers.  There
     are many different ways of partitioning a string of length n
     between the "+" and "*": one repetition with "b+" of length
     n, two repetitions with the first "b+" length k and the
     second with length n-k, m repetitions whose bits add up to
     length n, etc.  In fact there are an exponential number of
     ways to partition a string as a function of its length.  A
     regexp may get lucky and match early in the process, but if
     there is no match, Perl will try every possibility before
     giving up.  So be careful with nested "*"'s, "{n,m}"'s, and
     "+"'s.  The book Mastering Regular Expressions by Jeffrey
     Friedl gives a wonderful discussion of this and other
     efficiency issues.

  Possessive quantifiers
     Backtracking during the relentless search for a match may be
     a waste of time, particularly when the match is bound to
     fail.  Consider the simple pattern

         /^\w+\s+\w+$/; # a word, spaces, a word

     Whenever this is applied to a string which doesn't quite
     meet the pattern's expectations such as "abc  " or
     "abc  def ", the regex engine will backtrack, approximately
     once for each character in the string.  But we know that
     there is no way around taking all of the initial word
     characters to match the first repetition, that all spaces
     must be eaten by the middle part, and the same goes for the
     second word.



perl v5.12.5         Last change: 2012-11-03                   24






Perl Programmers Reference Guide                     PERLRETUT(1)



     With the introduction of the possessive quantifiers in Perl
     5.10, we have a way of instructing the regex engine not to
     backtrack, with the usual quantifiers with a "+" appended to
     them.  This makes them greedy as well as stingy; once they
     succeed they won't give anything back to permit another
     solution. They have the following meanings:

     o   "a{n,m}+" means: match at least "n" times, not more than
         "m" times, as many times as possible, and don't give
         anything up. "a?+" is short for "a{0,1}+"

     o   "a{n,}+" means: match at least "n" times, but as many
         times as possible, and don't give anything up. "a*+" is
         short for "a{0,}+" and "a++" is short for "a{1,}+".

     o   "a{n}+" means: match exactly "n" times.  It is just
         there for notational consistency.

     These possessive quantifiers represent a special case of a
     more general concept, the independent subexpression, see
     below.

     As an example where a possessive quantifier is suitable we
     consider matching a quoted string, as it appears in several
     programming languages.  The backslash is used as an escape
     character that indicates that the next character is to be
     taken literally, as another character for the string.
     Therefore, after the opening quote, we expect a (possibly
     empty) sequence of alternatives: either some character
     except an unescaped quote or backslash or an escaped
     character.

         /"(?:[^"\\]++|\\.)*+"/;

  Building a regexp
     At this point, we have all the basic regexp concepts
     covered, so let's give a more involved example of a regular
     expression.  We will build a regexp that matches numbers.

     The first task in building a regexp is to decide what we
     want to match and what we want to exclude.  In our case, we
     want to match both integers and floating point numbers and
     we want to reject any string that isn't a number.

     The next task is to break the problem down into smaller
     problems that are easily converted into a regexp.

     The simplest case is integers.  These consist of a sequence
     of digits, with an optional sign in front.  The digits we
     can represent with "\d+" and the sign can be matched with
     "[+-]".  Thus the integer regexp is




perl v5.12.5         Last change: 2012-11-03                   25






Perl Programmers Reference Guide                     PERLRETUT(1)



         /[+-]?\d+/;  # matches integers

     A floating point number potentially has a sign, an integral
     part, a decimal point, a fractional part, and an exponent.
     One or more of these parts is optional, so we need to check
     out the different possibilities.  Floating point numbers
     which are in proper form include 123., 0.345, .34, -1e6, and
     25.4E-72.  As with integers, the sign out front is
     completely optional and can be matched by "[+-]?".  We can
     see that if there is no exponent, floating point numbers
     must have a decimal point, otherwise they are integers.  We
     might be tempted to model these with "\d*\.\d*", but this
     would also match just a single decimal point, which is not a
     number.  So the three cases of floating point number without
     exponent are

        /[+-]?\d+\./;  # 1., 321., etc.
        /[+-]?\.\d+/;  # .1, .234, etc.
        /[+-]?\d+\.\d+/;  # 1.0, 30.56, etc.

     These can be combined into a single regexp with a three-way
     alternation:

        /[+-]?(\d+\.\d+|\d+\.|\.\d+)/;  # floating point, no exponent

     In this alternation, it is important to put '\d+\.\d+'
     before '\d+\.'.  If '\d+\.' were first, the regexp would
     happily match that and ignore the fractional part of the
     number.

     Now consider floating point numbers with exponents.  The key
     observation here is that both integers and numbers with
     decimal points are allowed in front of an exponent.  Then
     exponents, like the overall sign, are independent of whether
     we are matching numbers with or without decimal points, and
     can be 'decoupled' from the mantissa.  The overall form of
     the regexp now becomes clear:

         /^(optional sign)(integer | f.p. mantissa)(optional exponent)$/;

     The exponent is an "e" or "E", followed by an integer.  So
     the exponent regexp is

        /[eE][+-]?\d+/;  # exponent

     Putting all the parts together, we get a regexp that matches
     numbers:

        /^[+-]?(\d+\.\d+|\d+\.|\.\d+|\d+)([eE][+-]?\d+)?$/;  # Ta da!

     Long regexps like this may impress your friends, but can be
     hard to decipher.  In complex situations like this, the



perl v5.12.5         Last change: 2012-11-03                   26






Perl Programmers Reference Guide                     PERLRETUT(1)



     "//x" modifier for a match is invaluable.  It allows one to
     put nearly arbitrary whitespace and comments into a regexp
     without affecting their meaning.  Using it, we can rewrite
     our 'extended' regexp in the more pleasing form

        /^
           [+-]?         # first, match an optional sign
           (             # then match integers or f.p. mantissas:
               \d+\.\d+  # mantissa of the form a.b
              |\d+\.     # mantissa of the form a.
              |\.\d+     # mantissa of the form .b
              |\d+       # integer of the form a
           )
           ([eE][+-]?\d+)?  # finally, optionally match an exponent
        $/x;

     If whitespace is mostly irrelevant, how does one include
     space characters in an extended regexp? The answer is to
     backslash it '\ ' or put it in a character class "[ ]".  The
     same thing goes for pound signs, use "\#" or "[#]".  For
     instance, Perl allows a space between the sign and the
     mantissa or integer, and we could add this to our regexp as
     follows:

        /^
           [+-]?\ *      # first, match an optional sign *and space*
           (             # then match integers or f.p. mantissas:
               \d+\.\d+  # mantissa of the form a.b
              |\d+\.     # mantissa of the form a.
              |\.\d+     # mantissa of the form .b
              |\d+       # integer of the form a
           )
           ([eE][+-]?\d+)?  # finally, optionally match an exponent
        $/x;

     In this form, it is easier to see a way to simplify the
     alternation.  Alternatives 1, 2, and 4 all start with "\d+",
     so it could be factored out:

        /^
           [+-]?\ *      # first, match an optional sign
           (             # then match integers or f.p. mantissas:
               \d+       # start out with a ...
               (
                   \.\d* # mantissa of the form a.b or a.
               )?        # ? takes care of integers of the form a
              |\.\d+     # mantissa of the form .b
           )
           ([eE][+-]?\d+)?  # finally, optionally match an exponent
        $/x;





perl v5.12.5         Last change: 2012-11-03                   27






Perl Programmers Reference Guide                     PERLRETUT(1)



     or written in the compact form,

         /^[+-]?\ *(\d+(\.\d*)?|\.\d+)([eE][+-]?\d+)?$/;

     This is our final regexp.  To recap, we built a regexp by

     o   specifying the task in detail,

     o   breaking down the problem into smaller parts,

     o   translating the small parts into regexps,

     o   combining the regexps,

     o   and optimizing the final combined regexp.

     These are also the typical steps involved in writing a
     computer program.  This makes perfect sense, because regular
     expressions are essentially programs written in a little
     computer language that specifies patterns.

  Using regular expressions in Perl
     The last topic of Part 1 briefly covers how regexps are used
     in Perl programs.  Where do they fit into Perl syntax?

     We have already introduced the matching operator in its
     default "/regexp/" and arbitrary delimiter "m!regexp!"
     forms.  We have used the binding operator "=~" and its
     negation "!~" to test for string matches.  Associated with
     the matching operator, we have discussed the single line
     "//s", multi-line "//m", case-insensitive "//i" and extended
     "//x" modifiers.  There are a few more things you might want
     to know about matching operators.

     Optimizing pattern evaluation

     We pointed out earlier that variables in regexps are
     substituted before the regexp is evaluated:

         $pattern = 'Seuss';
         while (<>) {
             print if /$pattern/;
         }

     This will print any lines containing the word "Seuss".  It
     is not as efficient as it could be, however, because Perl
     has to re-evaluate (or compile) $pattern each time through
     the loop.  If $pattern won't be changing over the lifetime
     of the script, we can add the "//o" modifier, which directs
     Perl to only perform variable substitutions once:





perl v5.12.5         Last change: 2012-11-03                   28






Perl Programmers Reference Guide                     PERLRETUT(1)



         #!/usr/bin/perl
         #    Improved simple_grep
         $regexp = shift;
         while (<>) {
             print if /$regexp/o;  # a good deal faster
         }

     Prohibiting substitution

     If you change $pattern after the first substitution happens,
     Perl will ignore it.  If you don't want any substitutions at
     all, use the special delimiter "m''":

         @pattern = ('Seuss');
         while (<>) {
             print if m'@pattern';  # matches literal '@pattern', not 'Seuss'
         }

     Similar to strings, "m''" acts like apostrophes on a regexp;
     all other "m" delimiters act like quotes.  If the regexp
     evaluates to the empty string, the regexp in the last
     successful match is used instead.  So we have

         "dog" =~ /d/;  # 'd' matches
         "dogbert =~ //;  # this matches the 'd' regexp used before

     Global matching

     The final two modifiers "//g" and "//c" concern multiple
     matches.  The modifier "//g" stands for global matching and
     allows the matching operator to match within a string as
     many times as possible.  In scalar context, successive
     invocations against a string will have `"//g" jump from
     match to match, keeping track of position in the string as
     it goes along.  You can get or set the position with the
     "pos()" function.

     The use of "//g" is shown in the following example.  Suppose
     we have a string that consists of words separated by spaces.
     If we know how many words there are in advance, we could
     extract the words using groupings:

         $x = "cat dog house"; # 3 words
         $x =~ /^\s*(\w+)\s+(\w+)\s+(\w+)\s*$/; # matches,
                                                # $1 = 'cat'
                                                # $2 = 'dog'
                                                # $3 = 'house'

     But what if we had an indeterminate number of words? This is
     the sort of task "//g" was made for.  To extract all words,
     form the simple regexp "(\w+)" and loop over all matches
     with "/(\w+)/g":



perl v5.12.5         Last change: 2012-11-03                   29






Perl Programmers Reference Guide                     PERLRETUT(1)



         while ($x =~ /(\w+)/g) {
             print "Word is $1, ends at position ", pos $x, "\n";
         }

     prints

         Word is cat, ends at position 3
         Word is dog, ends at position 7
         Word is house, ends at position 13

     A failed match or changing the target string resets the
     position.  If you don't want the position reset after
     failure to match, add the "//c", as in "/regexp/gc".  The
     current position in the string is associated with the
     string, not the regexp.  This means that different strings
     have different positions and their respective positions can
     be set or read independently.

     In list context, "//g" returns a list of matched groupings,
     or if there are no groupings, a list of matches to the whole
     regexp.  So if we wanted just the words, we could use

         @words = ($x =~ /(\w+)/g);  # matches,
                                     # $word[0] = 'cat'
                                     # $word[1] = 'dog'
                                     # $word[2] = 'house'

     Closely associated with the "//g" modifier is the "\G"
     anchor.  The "\G" anchor matches at the point where the
     previous "//g" match left off.  "\G" allows us to easily do
     context-sensitive matching:

         $metric = 1;  # use metric units
         ...
         $x = <FILE>;  # read in measurement
         $x =~ /^([+-]?\d+)\s*/g;  # get magnitude
         $weight = $1;
         if ($metric) { # error checking
             print "Units error!" unless $x =~ /\Gkg\./g;
         }
         else {
             print "Units error!" unless $x =~ /\Glbs\./g;
         }
         $x =~ /\G\s+(widget|sprocket)/g;  # continue processing

     The combination of "//g" and "\G" allows us to process the
     string a bit at a time and use arbitrary Perl logic to
     decide what to do next.  Currently, the "\G" anchor is only
     fully supported when used to anchor to the start of the
     pattern.





perl v5.12.5         Last change: 2012-11-03                   30






Perl Programmers Reference Guide                     PERLRETUT(1)



     "\G" is also invaluable in processing fixed length records
     with regexps.  Suppose we have a snippet of coding region
     DNA, encoded as base pair letters "ATCGTTGAAT..." and we
     want to find all the stop codons "TGA".  In a coding region,
     codons are 3-letter sequences, so we can think of the DNA
     snippet as a sequence of 3-letter records.  The naive regexp

         # expanded, this is "ATC GTT GAA TGC AAA TGA CAT GAC"
         $dna = "ATCGTTGAATGCAAATGACATGAC";
         $dna =~ /TGA/;

     doesn't work; it may match a "TGA", but there is no
     guarantee that the match is aligned with codon boundaries,
     e.g., the substring "GTT GAA" gives a match.  A better
     solution is

         while ($dna =~ /(\w\w\w)*?TGA/g) {  # note the minimal *?
             print "Got a TGA stop codon at position ", pos $dna, "\n";
         }

     which prints

         Got a TGA stop codon at position 18
         Got a TGA stop codon at position 23

     Position 18 is good, but position 23 is bogus.  What
     happened?

     The answer is that our regexp works well until we get past
     the last real match.  Then the regexp will fail to match a
     synchronized "TGA" and start stepping ahead one character
     position at a time, not what we want.  The solution is to
     use "\G" to anchor the match to the codon alignment:

         while ($dna =~ /\G(\w\w\w)*?TGA/g) {
             print "Got a TGA stop codon at position ", pos $dna, "\n";
         }

     This prints

         Got a TGA stop codon at position 18

     which is the correct answer.  This example illustrates that
     it is important not only to match what is desired, but to
     reject what is not desired.

     Search and replace

     Regular expressions also play a big role in search and
     replace operations in Perl.  Search and replace is
     accomplished with the "s///" operator.  The general form is
     "s/regexp/replacement/modifiers", with everything we know



perl v5.12.5         Last change: 2012-11-03                   31






Perl Programmers Reference Guide                     PERLRETUT(1)



     about regexps and modifiers applying in this case as well.
     The "replacement" is a Perl double quoted string that
     replaces in the string whatever is matched with the
     "regexp".  The operator "=~" is also used here to associate
     a string with "s///".  If matching against $_, the "$_ =~"
     can be dropped.  If there is a match, "s///" returns the
     number of substitutions made, otherwise it returns false.
     Here are a few examples:

         $x = "Time to feed the cat!";
         $x =~ s/cat/hacker/;   # $x contains "Time to feed the hacker!"
         if ($x =~ s/^(Time.*hacker)!$/$1 now!/) {
             $more_insistent = 1;
         }
         $y = "'quoted words'";
         $y =~ s/^'(.*)'$/$1/;  # strip single quotes,
                                # $y contains "quoted words"

     In the last example, the whole string was matched, but only
     the part inside the single quotes was grouped.  With the
     "s///" operator, the matched variables $1, $2, etc.  are
     immediately available for use in the replacement expression,
     so we use $1 to replace the quoted string with just what was
     quoted.  With the global modifier, "s///g" will search and
     replace all occurrences of the regexp in the string:

         $x = "I batted 4 for 4";
         $x =~ s/4/four/;   # doesn't do it all:
                            # $x contains "I batted four for 4"
         $x = "I batted 4 for 4";
         $x =~ s/4/four/g;  # does it all:
                            # $x contains "I batted four for four"

     If you prefer 'regex' over 'regexp' in this tutorial, you
     could use the following program to replace it:

         % cat > simple_replace
         #!/usr/bin/perl
         $regexp = shift;
         $replacement = shift;
         while (<>) {
             s/$regexp/$replacement/go;
             print;
         }
         ^D

         % simple_replace regexp regex perlretut.pod

     In "simple_replace" we used the "s///g" modifier to replace
     all occurrences of the regexp on each line and the "s///o"
     modifier to compile the regexp only once.  As with
     "simple_grep", both the "print" and the



perl v5.12.5         Last change: 2012-11-03                   32






Perl Programmers Reference Guide                     PERLRETUT(1)



     "s/$regexp/$replacement/go" use $_ implicitly.

     A modifier available specifically to search and replace is
     the "s///e" evaluation modifier.  "s///e" wraps an
     "eval{...}" around the replacement string and the evaluated
     result is substituted for the matched substring.  "s///e" is
     useful if you need to do a bit of computation in the process
     of replacing text.  This example counts character
     frequencies in a line:

         $x = "Bill the cat";
         $x =~ s/(.)/$chars{$1}++;$1/eg;  # final $1 replaces char with itself
         print "frequency of '$_' is $chars{$_}\n"
             foreach (sort {$chars{$b} <=> $chars{$a}} keys %chars);

     This prints

         frequency of ' ' is 2
         frequency of 't' is 2
         frequency of 'l' is 2
         frequency of 'B' is 1
         frequency of 'c' is 1
         frequency of 'e' is 1
         frequency of 'h' is 1
         frequency of 'i' is 1
         frequency of 'a' is 1

     As with the match "m//" operator, "s///" can use other
     delimiters, such as "s!!!" and "s{}{}", and even "s{}//".
     If single quotes are used "s'''", then the regexp and
     replacement are treated as single quoted strings and there
     are no substitutions.  "s///" in list context returns the
     same thing as in scalar context, i.e., the number of
     matches.

     The split function

     The "split()" function is another place where a regexp is
     used.  "split /regexp/, string, limit" separates the
     "string" operand into a list of substrings and returns that
     list.  The regexp must be designed to match whatever
     constitutes the separators for the desired substrings.  The
     "limit", if present, constrains splitting into no more than
     "limit" number of strings.  For example, to split a string
     into words, use

         $x = "Calvin and Hobbes";
         @words = split /\s+/, $x;  # $word[0] = 'Calvin'
                                    # $word[1] = 'and'
                                    # $word[2] = 'Hobbes'





perl v5.12.5         Last change: 2012-11-03                   33






Perl Programmers Reference Guide                     PERLRETUT(1)



     If the empty regexp "//" is used, the regexp always matches
     and the string is split into individual characters.  If the
     regexp has groupings, then the resulting list contains the
     matched substrings from the groupings as well.  For
     instance,

         $x = "/usr/bin/perl";
         @dirs = split m!/!, $x;  # $dirs[0] = ''
                                  # $dirs[1] = 'usr'
                                  # $dirs[2] = 'bin'
                                  # $dirs[3] = 'perl'
         @parts = split m!(/)!, $x;  # $parts[0] = ''
                                     # $parts[1] = '/'
                                     # $parts[2] = 'usr'
                                     # $parts[3] = '/'
                                     # $parts[4] = 'bin'
                                     # $parts[5] = '/'
                                     # $parts[6] = 'perl'

     Since the first character of $x matched the regexp, "split"
     prepended an empty initial element to the list.

     If you have read this far, congratulations! You now have all
     the basic tools needed to use regular expressions to solve a
     wide range of text processing problems.  If this is your
     first time through the tutorial, why not stop here and play
     around with regexps a while...  Part 2 concerns the more
     esoteric aspects of regular expressions and those concepts
     certainly aren't needed right at the start.

Part 2: Power tools
     OK, you know the basics of regexps and you want to know
     more.  If matching regular expressions is analogous to a
     walk in the woods, then the tools discussed in Part 1 are
     analogous to topo maps and a compass, basic tools we use all
     the time.  Most of the tools in part 2 are analogous to
     flare guns and satellite phones.  They aren't used too often
     on a hike, but when we are stuck, they can be invaluable.

     What follows are the more advanced, less used, or sometimes
     esoteric capabilities of Perl regexps.  In Part 2, we will
     assume you are comfortable with the basics and concentrate
     on the new features.

  More on characters, strings, and character classes
     There are a number of escape sequences and character classes
     that we haven't covered yet.

     There are several escape sequences that convert characters
     or strings between upper and lower case, and they are also
     available within patterns.  "\l" and "\u" convert the next
     character to lower or upper case, respectively:



perl v5.12.5         Last change: 2012-11-03                   34






Perl Programmers Reference Guide                     PERLRETUT(1)



         $x = "perl";
         $string =~ /\u$x/;  # matches 'Perl' in $string
         $x = "M(rs?|s)\\."; # note the double backslash
         $string =~ /\l$x/;  # matches 'mr.', 'mrs.', and 'ms.',

     A "\L" or "\U" indicates a lasting conversion of case, until
     terminated by "\E" or thrown over by another "\U" or "\L":

         $x = "This word is in lower case:\L SHOUT\E";
         $x =~ /shout/;       # matches
         $x = "I STILL KEYPUNCH CARDS FOR MY 360"
         $x =~ /\Ukeypunch/;  # matches punch card string

     If there is no "\E", case is converted until the end of the
     string. The regexps "\L\u$word" or "\u\L$word" convert the
     first character of $word to uppercase and the rest of the
     characters to lowercase.

     Control characters can be escaped with "\c", so that a
     control-Z character would be matched with "\cZ".  The escape
     sequence "\Q"..."\E" quotes, or protects most non-alphabetic
     characters.   For instance,

         $x = "\QThat !^*&%~& cat!";
         $x =~ /\Q!^*&%~&\E/;  # check for rough language

     It does not protect "$" or "@", so that variables can still
     be substituted.

     With the advent of 5.6.0, Perl regexps can handle more than
     just the standard ASCII character set.  Perl now supports
     Unicode, a standard for representing the alphabets from
     virtually all of the world's written languages, and a host
     of symbols.  Perl's text strings are Unicode strings, so
     they can contain characters with a value (codepoint or
     character number) higher than 255

     What does this mean for regexps? Well, regexp users don't
     need to know much about Perl's internal representation of
     strings.  But they do need to know 1) how to represent
     Unicode characters in a regexp and 2) that a matching
     operation will treat the string to be searched as a sequence
     of characters, not bytes.  The answer to 1) is that Unicode
     characters greater than "chr(255)" are represented using the
     "\x{hex}" notation, because the \0 octal and \x hex (without
     curly braces) don't go further than 255.

         /\x{263a}/;  # match a Unicode smiley face :)

     NOTE: In Perl 5.6.0 it used to be that one needed to say
     "use utf8" to use any Unicode features.  This is no more the
     case: for almost all Unicode processing, the explicit "utf8"



perl v5.12.5         Last change: 2012-11-03                   35






Perl Programmers Reference Guide                     PERLRETUT(1)



     pragma is not needed.  (The only case where it matters is if
     your Perl script is in Unicode and encoded in UTF-8, then an
     explicit "use utf8" is needed.)

     Figuring out the hexadecimal sequence of a Unicode character
     you want or deciphering someone else's hexadecimal Unicode
     regexp is about as much fun as programming in machine code.
     So another way to specify Unicode characters is to use the
     named character escape sequence "\N{name}".  name is a name
     for the Unicode character, as specified in the Unicode
     standard.  For instance, if we wanted to represent or match
     the astrological sign for the planet Mercury, we could use

         use charnames ":full"; # use named chars with Unicode full names
         $x = "abc\N{MERCURY}def";
         $x =~ /\N{MERCURY}/;   # matches

     One can also use short names or restrict names to a certain
     alphabet:

         use charnames ':full';
         print "\N{GREEK SMALL LETTER SIGMA} is called sigma.\n";

         use charnames ":short";
         print "\N{greek:Sigma} is an upper-case sigma.\n";

         use charnames qw(greek);
         print "\N{sigma} is Greek sigma\n";

     A list of full names is found in the file NamesList.txt in
     the lib/perl5/X.X.X/unicore directory (where X.X.X is the
     perl version number as it is installed on your system).

     The answer to requirement 2), as of 5.6.0, is that a regexp
     uses Unicode characters. Internally, this is encoded to
     bytes using either UTF-8 or a native 8 bit encoding,
     depending on the history of the string, but conceptually it
     is a sequence of characters, not bytes. See perlunitut for a
     tutorial about that.

     Let us now discuss Unicode character classes.  Just as with
     Unicode characters, there are named Unicode character
     classes represented by the "\p{name}" escape sequence.
     Closely associated is the "\P{name}" character class, which
     is the negation of the "\p{name}" class.  For example, to
     match lower and uppercase characters,









perl v5.12.5         Last change: 2012-11-03                   36






Perl Programmers Reference Guide                     PERLRETUT(1)



         use charnames ":full"; # use named chars with Unicode full names
         $x = "BOB";
         $x =~ /^\p{IsUpper}/;   # matches, uppercase char class
         $x =~ /^\P{IsUpper}/;   # doesn't match, char class sans uppercase
         $x =~ /^\p{IsLower}/;   # doesn't match, lowercase char class
         $x =~ /^\P{IsLower}/;   # matches, char class sans lowercase

     Here is the association between some Perl named classes and
     the traditional Unicode classes:

         Perl class name  Unicode class name or regular expression

         IsAlpha          /^[LM]/
         IsAlnum          /^[LMN]/
         IsASCII          $code <= 127
         IsCntrl          /^C/
         IsBlank          $code =~ /^(0020|0009)$/ || /^Z[^lp]/
         IsDigit          Nd
         IsGraph          /^([LMNPS]|Co)/
         IsLower          Ll
         IsPrint          /^([LMNPS]|Co|Zs)/
         IsPunct          /^P/
         IsSpace          /^Z/ || ($code =~ /^(0009|000A|000B|000C|000D)$/
         IsSpacePerl      /^Z/ || ($code =~ /^(0009|000A|000C|000D|0085|2028|2029)$/
         IsUpper          /^L[ut]/
         IsWord           /^[LMN]/ || $code eq "005F"
         IsXDigit         $code =~ /^00(3[0-9]|[46][1-6])$/

     You can also use the official Unicode class names with the
     "\p" and "\P", like "\p{L}" for Unicode 'letters', or
     "\p{Lu}" for uppercase letters, or "\P{Nd}" for non-digits.
     If a "name" is just one letter, the braces can be dropped.
     For instance, "\pM" is the character class of Unicode
     'marks', for example accent marks.  For the full list see
     perlunicode.

     The Unicode has also been separated into various sets of
     characters which you can test with "\p{...}" (in) and
     "\P{...}" (not in).  To test whether a character is (or is
     not) an element of a script you would use the script name,
     for example "\p{Latin}", "\p{Greek}", or "\P{Katakana}".
     Other sets are the Unicode blocks, the names of which begin
     with "In". One such block is dedicated to mathematical
     operators, and its pattern formula is
     <C\p{InMathematicalOperators>}>.  For the full list see
     perluniprops.

     What we have described so far is the single form of the
     "\p{...}" character classes.  There is also a compound form
     which you may run into.  These look like "\p{name=value}" or
     "\p{name:value}" (the equals sign and colon can be used
     interchangeably).  These are more general than the single



perl v5.12.5         Last change: 2012-11-03                   37






Perl Programmers Reference Guide                     PERLRETUT(1)



     form, and in fact most of the single forms are just Perl-
     defined shortcuts for common compound forms.  For example,
     the script examples in the previous paragraph could be
     written equivalently as "\p{Script=Latin}",
     "\p{Script:Greek}", and "\P{script=katakana}" (case is
     irrelevant between the "{}" braces).  You may never have to
     use the compound forms, but sometimes it is necessary, and
     their use can make your code easier to understand.

     "\X" is an abbreviation for a character class that comprises
     a Unicode extended grapheme cluster.  This represents a
     "logical character", what appears to be a single character,
     but may be represented internally by more than one.  As an
     example, using the Unicode full names, e.g.,
     "A + COMBINING RING" is a grapheme cluster with base
     character "A" and combining character "COMBINING RING",
     which translates in Danish to A with the circle atop it, as
     in the word Angstrom.

     For the full and latest information about Unicode see the
     latest Unicode standard, or the Unicode Consortium's website
     <http://www.unicode.org>

     As if all those classes weren't enough, Perl also defines
     POSIX style character classes.  These have the form
     "[:name:]", with "name" the name of the POSIX class.  The
     POSIX classes are "alpha", "alnum", "ascii", "cntrl",
     "digit", "graph", "lower", "print", "punct", "space",
     "upper", and "xdigit", and two extensions, "word" (a Perl
     extension to match "\w"), and "blank" (a GNU extension).  If
     "utf8" is being used, then these classes are defined the
     same as their corresponding Perl Unicode classes:
     "[:upper:]" is the same as "\p{IsUpper}", etc.  The POSIX
     character classes, however, don't require using "utf8".  The
     "[:digit:]", "[:word:]", and "[:space:]" correspond to the
     familiar "\d", "\w", and "\s" character classes.  To negate
     a POSIX class, put a "^" in front of the name, so that,
     e.g., "[:^digit:]" corresponds to "\D" and under "utf8",
     "\P{IsDigit}".  The Unicode and POSIX character classes can
     be used just like "\d", with the exception that POSIX
     character classes can only be used inside of a character
     class:

         /\s+[abc[:digit:]xyz]\s*/;  # match a,b,c,x,y,z, or a digit
         /^=item\s[[:digit:]]/;      # match '=item',
                                     # followed by a space and a digit
         use charnames ":full";
         /\s+[abc\p{IsDigit}xyz]\s+/;  # match a,b,c,x,y,z, or a digit
         /^=item\s\p{IsDigit}/;        # match '=item',
                                       # followed by a space and a digit





perl v5.12.5         Last change: 2012-11-03                   38






Perl Programmers Reference Guide                     PERLRETUT(1)



     Whew! That is all the rest of the characters and character
     classes.

  Compiling and saving regular expressions
     In Part 1 we discussed the "//o" modifier, which compiles a
     regexp just once.  This suggests that a compiled regexp is
     some data structure that can be stored once and used again
     and again.  The regexp quote "qr//" does exactly that:
     "qr/string/" compiles the "string" as a regexp and
     transforms the result into a form that can be assigned to a
     variable:

         $reg = qr/foo+bar?/;  # reg contains a compiled regexp

     Then $reg can be used as a regexp:

         $x = "fooooba";
         $x =~ $reg;     # matches, just like /foo+bar?/
         $x =~ /$reg/;   # same thing, alternate form

     $reg can also be interpolated into a larger regexp:

         $x =~ /(abc)?$reg/;  # still matches

     As with the matching operator, the regexp quote can use
     different delimiters, e.g., "qr!!", "qr{}" or "qr~~".
     Apostrophes as delimiters ("qr''") inhibit any
     interpolation.

     Pre-compiled regexps are useful for creating dynamic matches
     that don't need to be recompiled each time they are
     encountered.  Using pre-compiled regexps, we write a
     "grep_step" program which greps for a sequence of patterns,
     advancing to the next pattern as soon as one has been
     satisfied.

         % cat > grep_step
         #!/usr/bin/perl
         # grep_step - match <number> regexps, one after the other
         # usage: multi_grep <number> regexp1 regexp2 ... file1 file2 ...

         $number = shift;
         $regexp[$_] = shift foreach (0..$number-1);
         @compiled = map qr/$_/, @regexp;
         while ($line = <>) {
             if ($line =~ /$compiled[0]/) {
                 print $line;
                 shift @compiled;
                 last unless @compiled;
             }
         }
         ^D



perl v5.12.5         Last change: 2012-11-03                   39






Perl Programmers Reference Guide                     PERLRETUT(1)




         % grep_step 3 shift print last grep_step
         $number = shift;
                 print $line;
                 last unless @compiled;

     Storing pre-compiled regexps in an array @compiled allows us
     to simply loop through the regexps without any
     recompilation, thus gaining flexibility without sacrificing
     speed.

  Composing regular expressions at runtime
     Backtracking is more efficient than repeated tries with
     different regular expressions.  If there are several regular
     expressions and a match with any of them is acceptable, then
     it is possible to combine them into a set of alternatives.
     If the individual expressions are input data, this can be
     done by programming a join operation.  We'll exploit this
     idea in an improved version of the "simple_grep" program: a
     program that matches multiple patterns:

         % cat > multi_grep
         #!/usr/bin/perl
         # multi_grep - match any of <number> regexps
         # usage: multi_grep <number> regexp1 regexp2 ... file1 file2 ...

         $number = shift;
         $regexp[$_] = shift foreach (0..$number-1);
         $pattern = join '|', @regexp;

         while ($line = <>) {
             print $line if $line =~ /$pattern/o;
         }
         ^D

         % multi_grep 2 shift for multi_grep
         $number = shift;
         $regexp[$_] = shift foreach (0..$number-1);

     Sometimes it is advantageous to construct a pattern from the
     input that is to be analyzed and use the permissible values
     on the left hand side of the matching operations.  As an
     example for this somewhat paradoxical situation, let's
     assume that our input contains a command verb which should
     match one out of a set of available command verbs, with the
     additional twist that commands may be abbreviated as long as
     the given string is unique. The program below demonstrates
     the basic algorithm.







perl v5.12.5         Last change: 2012-11-03                   40






Perl Programmers Reference Guide                     PERLRETUT(1)



         % cat > keymatch
         #!/usr/bin/perl
         $kwds = 'copy compare list print';
         while( $command = <> ){
             $command =~ s/^\s+|\s+$//g;  # trim leading and trailing spaces
             if( ( @matches = $kwds =~ /\b$command\w*/g ) == 1 ){
                 print "command: '@matches'\n";
             } elsif( @matches == 0 ){
                 print "no such command: '$command'\n";
             } else {
                 print "not unique: '$command' (could be one of: @matches)\n";
             }
         }
         ^D

         % keymatch
         li
         command: 'list'
         co
         not unique: 'co' (could be one of: copy compare)
         printer
         no such command: 'printer'

     Rather than trying to match the input against the keywords,
     we match the combined set of keywords against the input.
     The pattern matching operation "$kwds =~ /\b($command\w*)/g"
     does several things at the same time. It makes sure that the
     given command begins where a keyword begins ("\b"). It
     tolerates abbreviations due to the added "\w*". It tells us
     the number of matches ("scalar @matches") and all the
     keywords that were actually matched.  You could hardly ask
     for more.

  Embedding comments and modifiers in a regular expression
     Starting with this section, we will be discussing Perl's set
     of extended patterns.  These are extensions to the
     traditional regular expression syntax that provide powerful
     new tools for pattern matching.  We have already seen
     extensions in the form of the minimal matching constructs
     "??", "*?", "+?", "{n,m}?", and "{n,}?".  The rest of the
     extensions below have the form "(?char...)", where the
     "char" is a character that determines the type of extension.

     The first extension is an embedded comment "(?#text)".  This
     embeds a comment into the regular expression without
     affecting its meaning.  The comment should not have any
     closing parentheses in the text.  An example is

         /(?# Match an integer:)[+-]?\d+/;

     This style of commenting has been largely superseded by the
     raw, freeform commenting that is allowed with the "//x"



perl v5.12.5         Last change: 2012-11-03                   41






Perl Programmers Reference Guide                     PERLRETUT(1)



     modifier.

     The modifiers "//i", "//m", "//s" and "//x" (or any
     combination thereof) can also be embedded in a regexp using
     "(?i)", "(?m)", "(?s)", and "(?x)".  For instance,

         /(?i)yes/;  # match 'yes' case insensitively
         /yes/i;     # same thing
         /(?x)(          # freeform version of an integer regexp
                  [+-]?  # match an optional sign
                  \d+    # match a sequence of digits
              )
         /x;

     Embedded modifiers can have two important advantages over
     the usual modifiers.  Embedded modifiers allow a custom set
     of modifiers to each regexp pattern.  This is great for
     matching an array of regexps that must have different
     modifiers:

         $pattern[0] = '(?i)doctor';
         $pattern[1] = 'Johnson';
         ...
         while (<>) {
             foreach $patt (@pattern) {
                 print if /$patt/;
             }
         }

     The second advantage is that embedded modifiers (except
     "//p", which modifies the entire regexp) only affect the
     regexp inside the group the embedded modifier is contained
     in.  So grouping can be used to localize the modifier's
     effects:

         /Answer: ((?i)yes)/;  # matches 'Answer: yes', 'Answer: YES', etc.

     Embedded modifiers can also turn off any modifiers already
     present by using, e.g., "(?-i)".  Modifiers can also be
     combined into a single expression, e.g., "(?s-i)" turns on
     single line mode and turns off case insensitivity.

     Embedded modifiers may also be added to a non-capturing
     grouping.  "(?i-m:regexp)" is a non-capturing grouping that
     matches "regexp" case insensitively and turns off multi-line
     mode.

  Looking ahead and looking behind
     This section concerns the lookahead and lookbehind
     assertions.  First, a little background.





perl v5.12.5         Last change: 2012-11-03                   42






Perl Programmers Reference Guide                     PERLRETUT(1)



     In Perl regular expressions, most regexp elements 'eat up' a
     certain amount of string when they match.  For instance, the
     regexp element "[abc}]" eats up one character of the string
     when it matches, in the sense that Perl moves to the next
     character position in the string after the match.  There are
     some elements, however, that don't eat up characters
     (advance the character position) if they match.  The
     examples we have seen so far are the anchors.  The anchor
     "^" matches the beginning of the line, but doesn't eat any
     characters.  Similarly, the word boundary anchor "\b"
     matches wherever a character matching "\w" is next to a
     character that doesn't, but it doesn't eat up any characters
     itself.  Anchors are examples of zero-width assertions.
     Zero-width, because they consume no characters, and
     assertions, because they test some property of the string.
     In the context of our walk in the woods analogy to regexp
     matching, most regexp elements move us along a trail, but
     anchors have us stop a moment and check our surroundings.
     If the local environment checks out, we can proceed forward.
     But if the local environment doesn't satisfy us, we must
     backtrack.

     Checking the environment entails either looking ahead on the
     trail, looking behind, or both.  "^" looks behind, to see
     that there are no characters before.  "$" looks ahead, to
     see that there are no characters after.  "\b" looks both
     ahead and behind, to see if the characters on either side
     differ in their "word-ness".

     The lookahead and lookbehind assertions are generalizations
     of the anchor concept.  Lookahead and lookbehind are zero-
     width assertions that let us specify which characters we
     want to test for.  The lookahead assertion is denoted by
     "(?=regexp)" and the lookbehind assertion is denoted by
     "(?<=fixed-regexp)".  Some examples are

         $x = "I catch the housecat 'Tom-cat' with catnip";
         $x =~ /cat(?=\s)/;   # matches 'cat' in 'housecat'
         @catwords = ($x =~ /(?<=\s)cat\w+/g);  # matches,
                                                # $catwords[0] = 'catch'
                                                # $catwords[1] = 'catnip'
         $x =~ /\bcat\b/;  # matches 'cat' in 'Tom-cat'
         $x =~ /(?<=\s)cat(?=\s)/; # doesn't match; no isolated 'cat' in
                                   # middle of $x

     Note that the parentheses in "(?=regexp)" and "(?<=regexp)"
     are non-capturing, since these are zero-width assertions.
     Thus in the second regexp, the substrings captured are those
     of the whole regexp itself.  Lookahead "(?=regexp)" can
     match arbitrary regexps, but lookbehind "(?<=fixed-regexp)"
     only works for regexps of fixed width, i.e., a fixed number
     of characters long.  Thus "(?<=(ab|bc))" is fine, but



perl v5.12.5         Last change: 2012-11-03                   43






Perl Programmers Reference Guide                     PERLRETUT(1)



     "(?<=(ab)*)" is not.  The negated versions of the lookahead
     and lookbehind assertions are denoted by "(?!regexp)" and
     "(?<!fixed-regexp)" respectively.  They evaluate true if the
     regexps do not match:

         $x = "foobar";
         $x =~ /foo(?!bar)/;  # doesn't match, 'bar' follows 'foo'
         $x =~ /foo(?!baz)/;  # matches, 'baz' doesn't follow 'foo'
         $x =~ /(?<!\s)foo/;  # matches, there is no \s before 'foo'

     The "\C" is unsupported in lookbehind, because the already
     treacherous definition of "\C" would become even more so
     when going backwards.

     Here is an example where a string containing blank-separated
     words, numbers and single dashes is to be split into its
     components.  Using "/\s+/" alone won't work, because spaces
     are not required between dashes, or a word or a dash.
     Additional places for a split are established by looking
     ahead and behind:

         $str = "one two - --6-8";
         @toks = split / \s+              # a run of spaces
                       | (?<=\S) (?=-)    # any non-space followed by '-'
                       | (?<=-)  (?=\S)   # a '-' followed by any non-space
                       /x, $str;          # @toks = qw(one two - - - 6 - 8)

  Using independent subexpressions to prevent backtracking
     Independent subexpressions are regular expressions, in the
     context of a larger regular expression, that function
     independently of the larger regular expression.  That is,
     they consume as much or as little of the string as they wish
     without regard for the ability of the larger regexp to
     match.  Independent subexpressions are represented by
     "(?>regexp)".  We can illustrate their behavior by first
     considering an ordinary regexp:

         $x = "ab";
         $x =~ /a*ab/;  # matches

     This obviously matches, but in the process of matching, the
     subexpression "a*" first grabbed the "a".  Doing so,
     however, wouldn't allow the whole regexp to match, so after
     backtracking, "a*" eventually gave back the "a" and matched
     the empty string.  Here, what "a*" matched was dependent on
     what the rest of the regexp matched.

     Contrast that with an independent subexpression:

         $x =~ /(?>a*)ab/;  # doesn't match!





perl v5.12.5         Last change: 2012-11-03                   44






Perl Programmers Reference Guide                     PERLRETUT(1)



     The independent subexpression "(?>a*)" doesn't care about
     the rest of the regexp, so it sees an "a" and grabs it.
     Then the rest of the regexp "ab" cannot match.  Because
     "(?>a*)" is independent, there is no backtracking and the
     independent subexpression does not give up its "a".  Thus
     the match of the regexp as a whole fails.  A similar
     behavior occurs with completely independent regexps:

         $x = "ab";
         $x =~ /a*/g;   # matches, eats an 'a'
         $x =~ /\Gab/g; # doesn't match, no 'a' available

     Here "//g" and "\G" create a 'tag team' handoff of the
     string from one regexp to the other.  Regexps with an
     independent subexpression are much like this, with a handoff
     of the string to the independent subexpression, and a
     handoff of the string back to the enclosing regexp.

     The ability of an independent subexpression to prevent
     backtracking can be quite useful.  Suppose we want to match
     a non-empty string enclosed in parentheses up to two levels
     deep.  Then the following regexp matches:

         $x = "abc(de(fg)h";  # unbalanced parentheses
         $x =~ /\( ( [^()]+ | \([^()]*\) )+ \)/x;

     The regexp matches an open parenthesis, one or more copies
     of an alternation, and a close parenthesis.  The alternation
     is two-way, with the first alternative "[^()]+" matching a
     substring with no parentheses and the second alternative
     "\([^()]*\)"  matching a substring delimited by parentheses.
     The problem with this regexp is that it is pathological: it
     has nested indeterminate quantifiers of the form "(a+|b)+".
     We discussed in Part 1 how nested quantifiers like this
     could take an exponentially long time to execute if there
     was no match possible.  To prevent the exponential blowup,
     we need to prevent useless backtracking at some point.  This
     can be done by enclosing the inner quantifier as an
     independent subexpression:

         $x =~ /\( ( (?>[^()]+) | \([^()]*\) )+ \)/x;

     Here, "(?>[^()]+)" breaks the degeneracy of string
     partitioning by gobbling up as much of the string as
     possible and keeping it.   Then match failures fail much
     more quickly.

  Conditional expressions
     A conditional expression is a form of if-then-else statement
     that allows one to choose which patterns are to be matched,
     based on some condition.  There are two types of conditional
     expression: "(?(condition)yes-regexp)" and



perl v5.12.5         Last change: 2012-11-03                   45






Perl Programmers Reference Guide                     PERLRETUT(1)



     "(?(condition)yes-regexp|no-regexp)".
     "(?(condition)yes-regexp)" is like an 'if () {}' statement
     in Perl.  If the "condition" is true, the "yes-regexp" will
     be matched.  If the "condition" is false, the "yes-regexp"
     will be skipped and Perl will move onto the next regexp
     element.  The second form is like an 'if () {} else {}'
     statement in Perl.  If the "condition" is true, the
     "yes-regexp" will be matched, otherwise the "no-regexp" will
     be matched.

     The "condition" can have several forms.  The first form is
     simply an integer in parentheses "(integer)".  It is true if
     the corresponding backreference "\integer" matched earlier
     in the regexp.  The same thing can be done with a name
     associated with a capture buffer, written as "(<name>)" or
     "('name')".  The second form is a bare zero width assertion
     "(?...)", either a lookahead, a lookbehind, or a code
     assertion (discussed in the next section).  The third set of
     forms provides tests that return true if the expression is
     executed within a recursion ("(R)") or is being called from
     some capturing group, referenced either by number ("(R1)",
     "(R2)",...) or by name ("(R&name)").

     The integer or name form of the "condition" allows us to
     choose, with more flexibility, what to match based on what
     matched earlier in the regexp. This searches for words of
     the form "$x$x" or "$x$y$y$x":

         % simple_grep '^(\w+)(\w+)?(?(2)\2\1|\1)$' /usr/dict/words
         beriberi
         coco
         couscous
         deed
         ...
         toot
         toto
         tutu

     The lookbehind "condition" allows, along with
     backreferences, an earlier part of the match to influence a
     later part of the match.  For instance,

         /[ATGC]+(?(?<=AA)G|C)$/;

     matches a DNA sequence such that it either ends in "AAG", or
     some other base pair combination and "C".  Note that the
     form is "(?(?<=AA)G|C)" and not "(?((?<=AA))G|C)"; for the
     lookahead, lookbehind or code assertions, the parentheses
     around the conditional are not needed.

  Defining named patterns
     Some regular expressions use identical subpatterns in



perl v5.12.5         Last change: 2012-11-03                   46






Perl Programmers Reference Guide                     PERLRETUT(1)



     several places.  Starting with Perl 5.10, it is possible to
     define named subpatterns in a section of the pattern so that
     they can be called up by name anywhere in the pattern.  This
     syntactic pattern for this definition group is
     "(?(DEFINE)(?<name>pattern)...)".  An insertion of a named
     pattern is written as "(?&name)".

     The example below illustrates this feature using the pattern
     for floating point numbers that was presented earlier on.
     The three subpatterns that are used more than once are the
     optional sign, the digit sequence for an integer and the
     decimal fraction.  The DEFINE group at the end of the
     pattern contains their definition.  Notice that the decimal
     fraction pattern is the first place where we can reuse the
     integer pattern.

        /^ (?&osg)\ * ( (?&int)(?&dec)? | (?&dec) )
           (?: [eE](?&osg)(?&int) )?
         $
         (?(DEFINE)
           (?<osg>[-+]?)         # optional sign
           (?<int>\d++)          # integer
           (?<dec>\.(?&int))     # decimal fraction
         )/x

  Recursive patterns
     This feature (introduced in Perl 5.10) significantly extends
     the power of Perl's pattern matching.  By referring to some
     other capture group anywhere in the pattern with the
     construct "(?group-ref)", the pattern within the referenced
     group is used as an independent subpattern in place of the
     group reference itself.  Because the group reference may be
     contained within the group it refers to, it is now possible
     to apply pattern matching to tasks that hitherto required a
     recursive parser.

     To illustrate this feature, we'll design a pattern that
     matches if a string contains a palindrome. (This is a word
     or a sentence that, while ignoring spaces, interpunctuation
     and case, reads the same backwards as forwards. We begin by
     observing that the empty string or a string containing just
     one word character is a palindrome. Otherwise it must have a
     word character up front and the same at its end, with
     another palindrome in between.

         /(?: (\w) (?...Here be a palindrome...) \g{-1} | \w? )/x

     Adding "\W*" at either end to eliminate what is to be
     ignored, we already have the full pattern:






perl v5.12.5         Last change: 2012-11-03                   47






Perl Programmers Reference Guide                     PERLRETUT(1)



         my $pp = qr/^(\W* (?: (\w) (?1) \g{-1} | \w? ) \W*)$/ix;
         for $s ( "saippuakauppias", "A man, a plan, a canal: Panama!" ){
             print "'$s' is a palindrome\n" if $s =~ /$pp/;
         }

     In "(?...)" both absolute and relative backreferences may be
     used.  The entire pattern can be reinserted with "(?R)" or
     "(?0)".  If you prefer to name your buffers, you can use
     "(?&name)" to recurse into that buffer.

  A bit of magic: executing Perl code in a regular expression

     Normally, regexps are a part of Perl expressions.  Code
     evaluation expressions turn that around by allowing
     arbitrary Perl code to be a part of a regexp.  A code
     evaluation expression is denoted "(?{code})", with code a
     string of Perl statements.

     Be warned that this feature is considered experimental, and
     may be changed without notice.

     Code expressions are zero-width assertions, and the value
     they return depends on their environment.  There are two
     possibilities: either the code expression is used as a
     conditional in a conditional expression "(?(condition)...)",
     or it is not.  If the code expression is a conditional, the
     code is evaluated and the result (i.e., the result of the
     last statement) is used to determine truth or falsehood.  If
     the code expression is not used as a conditional, the
     assertion always evaluates true and the result is put into
     the special variable $^R.  The variable $^R can then be used
     in code expressions later in the regexp.  Here are some
     silly examples:

         $x = "abcdef";
         $x =~ /abc(?{print "Hi Mom!";})def/; # matches,
                                              # prints 'Hi Mom!'
         $x =~ /aaa(?{print "Hi Mom!";})def/; # doesn't match,
                                              # no 'Hi Mom!'

     Pay careful attention to the next example:

         $x =~ /abc(?{print "Hi Mom!";})ddd/; # doesn't match,
                                              # no 'Hi Mom!'
                                              # but why not?

     At first glance, you'd think that it shouldn't print,
     because obviously the "ddd" isn't going to match the target
     string. But look at this example:

         $x =~ /abc(?{print "Hi Mom!";})[dD]dd/; # doesn't match,
                                                 # but _does_ print



perl v5.12.5         Last change: 2012-11-03                   48






Perl Programmers Reference Guide                     PERLRETUT(1)



     Hmm. What happened here? If you've been following along, you
     know that the above pattern should be effectively (almost)
     the same as the last one; enclosing the "d" in a character
     class isn't going to change what it matches. So why does the
     first not print while the second one does?

     The answer lies in the optimizations the regex engine makes.
     In the first case, all the engine sees are plain old
     characters (aside from the "?{}" construct). It's smart
     enough to realize that the string 'ddd' doesn't occur in our
     target string before actually running the pattern through.
     But in the second case, we've tricked it into thinking that
     our pattern is more complicated. It takes a look, sees our
     character class, and decides that it will have to actually
     run the pattern to determine whether or not it matches, and
     in the process of running it hits the print statement before
     it discovers that we don't have a match.

     To take a closer look at how the engine does optimizations,
     see the section "Pragmas and debugging" below.

     More fun with "?{}":

         $x =~ /(?{print "Hi Mom!";})/;       # matches,
                                              # prints 'Hi Mom!'
         $x =~ /(?{$c = 1;})(?{print "$c";})/;  # matches,
                                                # prints '1'
         $x =~ /(?{$c = 1;})(?{print "$^R";})/; # matches,
                                                # prints '1'

     The bit of magic mentioned in the section title occurs when
     the regexp backtracks in the process of searching for a
     match.  If the regexp backtracks over a code expression and
     if the variables used within are localized using "local",
     the changes in the variables produced by the code expression
     are undone! Thus, if we wanted to count how many times a
     character got matched inside a group, we could use, e.g.,

         $x = "aaaa";
         $count = 0;  # initialize 'a' count
         $c = "bob";  # test if $c gets clobbered
         $x =~ /(?{local $c = 0;})         # initialize count
                ( a                        # match 'a'
                  (?{local $c = $c + 1;})  # increment count
                )*                         # do this any number of times,
                aa                         # but match 'aa' at the end
                (?{$count = $c;})          # copy local $c var into $count
               /x;
         print "'a' count is $count, \$c variable is '$c'\n";

     This prints




perl v5.12.5         Last change: 2012-11-03                   49






Perl Programmers Reference Guide                     PERLRETUT(1)



         'a' count is 2, $c variable is 'bob'

     If we replace the " (?{local $c = $c + 1;})" with
     " (?{$c = $c + 1;})", the variable changes are not undone
     during backtracking, and we get

         'a' count is 4, $c variable is 'bob'

     Note that only localized variable changes are undone.  Other
     side effects of code expression execution are permanent.
     Thus

         $x = "aaaa";
         $x =~ /(a(?{print "Yow\n";}))*aa/;

     produces

        Yow
        Yow
        Yow
        Yow

     The result $^R is automatically localized, so that it will
     behave properly in the presence of backtracking.

     This example uses a code expression in a conditional to
     match a definite article, either 'the' in English or
     'der|die|das' in German:

         $lang = 'DE';  # use German
         ...
         $text = "das";
         print "matched\n"
             if $text =~ /(?(?{
                               $lang eq 'EN'; # is the language English?
                              })
                            the |             # if so, then match 'the'
                            (der|die|das)     # else, match 'der|die|das'
                          )
                         /xi;

     Note that the syntax here is
     "(?(?{...})yes-regexp|no-regexp)", not
     "(?((?{...}))yes-regexp|no-regexp)".  In other words, in the
     case of a code expression, we don't need the extra
     parentheses around the conditional.

     If you try to use code expressions with interpolating
     variables, Perl may surprise you:






perl v5.12.5         Last change: 2012-11-03                   50






Perl Programmers Reference Guide                     PERLRETUT(1)



         $bar = 5;
         $pat = '(?{ 1 })';
         /foo(?{ $bar })bar/; # compiles ok, $bar not interpolated
         /foo(?{ 1 })$bar/;   # compile error!
         /foo${pat}bar/;      # compile error!

         $pat = qr/(?{ $foo = 1 })/;  # precompile code regexp
         /foo${pat}bar/;      # compiles ok

     If a regexp has (1) code expressions and interpolating
     variables, or (2) a variable that interpolates a code
     expression, Perl treats the regexp as an error. If the code
     expression is precompiled into a variable, however,
     interpolating is ok. The question is, why is this an error?

     The reason is that variable interpolation and code
     expressions together pose a security risk.  The combination
     is dangerous because many programmers who write search
     engines often take user input and plug it directly into a
     regexp:

         $regexp = <>;       # read user-supplied regexp
         $chomp $regexp;     # get rid of possible newline
         $text =~ /$regexp/; # search $text for the $regexp

     If the $regexp variable contains a code expression, the user
     could then execute arbitrary Perl code.  For instance, some
     joker could search for "system('rm -rf *');" to erase your
     files.  In this sense, the combination of interpolation and
     code expressions taints your regexp.  So by default, using
     both interpolation and code expressions in the same regexp
     is not allowed.  If you're not concerned about malicious
     users, it is possible to bypass this security check by
     invoking "use re 'eval'":

         use re 'eval';       # throw caution out the door
         $bar = 5;
         $pat = '(?{ 1 })';
         /foo(?{ 1 })$bar/;   # compiles ok
         /foo${pat}bar/;      # compiles ok

     Another form of code expression is the pattern code
     expression.  The pattern code expression is like a regular
     code expression, except that the result of the code
     evaluation is treated as a regular expression and matched
     immediately.  A simple example is

         $length = 5;
         $char = 'a';
         $x = 'aaaaabb';
         $x =~ /(??{$char x $length})/x; # matches, there are 5 of 'a'




perl v5.12.5         Last change: 2012-11-03                   51






Perl Programmers Reference Guide                     PERLRETUT(1)



     This final example contains both ordinary and pattern code
     expressions.  It detects whether a binary string
     1101010010001... has a Fibonacci spacing 0,1,1,2,3,5,...  of
     the 1's:

         $x = "1101010010001000001";
         $z0 = ''; $z1 = '0';   # initial conditions
         print "It is a Fibonacci sequence\n"
             if $x =~ /^1         # match an initial '1'
                         (?:
                            ((??{ $z0 })) # match some '0'
                            1             # and then a '1'
                            (?{ $z0 = $z1; $z1 .= $^N; })
                         )+   # repeat as needed
                       $      # that is all there is
                      /x;
         printf "Largest sequence matched was %d\n", length($z1)-length($z0);

     Remember that $^N is set to whatever was matched by the last
     completed capture group. This prints

         It is a Fibonacci sequence
         Largest sequence matched was 5

     Ha! Try that with your garden variety regexp package...

     Note that the variables $z0 and $z1 are not substituted when
     the regexp is compiled, as happens for ordinary variables
     outside a code expression.  Rather, the code expressions are
     evaluated when Perl encounters them during the search for a
     match.

     The regexp without the "//x" modifier is

         /^1(?:((??{ $z0 }))1(?{ $z0 = $z1; $z1 .= $^N; }))+$/

     which shows that spaces are still possible in the code
     parts. Nevertheless, when working with code and conditional
     expressions, the extended form of regexps is almost
     necessary in creating and debugging regexps.

  Backtracking control verbs
     Perl 5.10 introduced a number of control verbs intended to
     provide detailed control over the backtracking process, by
     directly influencing the regexp engine and by providing
     monitoring techniques.  As all the features in this group
     are experimental and subject to change or removal in a
     future version of Perl, the interested reader is referred to
     "Special Backtracking Control Verbs" in perlre for a
     detailed description.





perl v5.12.5         Last change: 2012-11-03                   52






Perl Programmers Reference Guide                     PERLRETUT(1)



     Below is just one example, illustrating the control verb
     "(*FAIL)", which may be abbreviated as "(*F)". If this is
     inserted in a regexp it will cause to fail, just like at
     some mismatch between the pattern and the string. Processing
     of the regexp continues like after any "normal" failure, so
     that, for instance, the next position in the string or
     another alternative will be tried. As failing to match
     doesn't preserve capture buffers or produce results, it may
     be necessary to use this in combination with embedded code.

        %count = ();
        "supercalifragilisticexpialidoceous" =~
            /([aeiou])(?{ $count{$1}++; })(*FAIL)/oi;
        printf "%3d '%s'\n", $count{$_}, $_ for (sort keys %count);

     The pattern begins with a class matching a subset of
     letters.  Whenever this matches, a statement like
     "$count{'a'}++;" is executed, incrementing the letter's
     counter. Then "(*FAIL)" does what it says, and the regexp
     engine proceeds according to the book: as long as the end of
     the string  hasn't been reached, the position is advanced
     before looking for another vowel. Thus, match or no match
     makes no difference, and the regexp engine proceeds until
     the entire string has been inspected.  (It's remarkable that
     an alternative solution using something like

        $count{lc($_)}++ for split('', "supercalifragilisticexpialidoceous");
        printf "%3d '%s'\n", $count2{$_}, $_ for ( qw{ a e i o u } );

     is considerably slower.)

  Pragmas and debugging
     Speaking of debugging, there are several pragmas available
     to control and debug regexps in Perl.  We have already
     encountered one pragma in the previous section,
     "use re 'eval';", that allows variable interpolation and
     code expressions to coexist in a regexp.  The other pragmas
     are

         use re 'taint';
         $tainted = <>;
         @parts = ($tainted =~ /(\w+)\s+(\w+)/; # @parts is now tainted

     The "taint" pragma causes any substrings from a match with a
     tainted variable to be tainted as well.  This is not
     normally the case, as regexps are often used to extract the
     safe bits from a tainted variable.  Use "taint" when you are
     not extracting safe bits, but are performing some other
     processing.  Both "taint" and "eval" pragmas are lexically
     scoped, which means they are in effect only until the end of
     the block enclosing the pragmas.




perl v5.12.5         Last change: 2012-11-03                   53






Perl Programmers Reference Guide                     PERLRETUT(1)



         use re 'debug';
         /^(.*)$/s;       # output debugging info

         use re 'debugcolor';
         /^(.*)$/s;       # output debugging info in living color

     The global "debug" and "debugcolor" pragmas allow one to get
     detailed debugging info about regexp compilation and
     execution.  "debugcolor" is the same as debug, except the
     debugging information is displayed in color on terminals
     that can display termcap color sequences.  Here is example
     output:

         % perl -e 'use re "debug"; "abc" =~ /a*b+c/;'
         Compiling REx `a*b+c'
         size 9 first at 1
            1: STAR(4)
            2:   EXACT <a>(0)
            4: PLUS(7)
            5:   EXACT <b>(0)
            7: EXACT <c>(9)
            9: END(0)
         floating `bc' at 0..2147483647 (checking floating) minlen 2
         Guessing start of match, REx `a*b+c' against `abc'...
         Found floating substr `bc' at offset 1...
         Guessed: match at offset 0
         Matching REx `a*b+c' against `abc'
           Setting an EVAL scope, savestack=3
            0 <> <abc>             |  1:  STAR
                                    EXACT <a> can match 1 times out of 32767...
           Setting an EVAL scope, savestack=3
            1 <a> <bc>             |  4:    PLUS
                                    EXACT <b> can match 1 times out of 32767...
           Setting an EVAL scope, savestack=3
            2 <ab> <c>             |  7:      EXACT <c>
            3 <abc> <>             |  9:      END
         Match successful!
         Freeing REx: `a*b+c'

     If you have gotten this far into the tutorial, you can
     probably guess what the different parts of the debugging
     output tell you.  The first part

         Compiling REx `a*b+c'
         size 9 first at 1
            1: STAR(4)
            2:   EXACT <a>(0)
            4: PLUS(7)
            5:   EXACT <b>(0)
            7: EXACT <c>(9)
            9: END(0)




perl v5.12.5         Last change: 2012-11-03                   54






Perl Programmers Reference Guide                     PERLRETUT(1)



     describes the compilation stage.  STAR(4) means that there
     is a starred object, in this case 'a', and if it matches,
     goto line 4, i.e., PLUS(7).  The middle lines describe some
     heuristics and optimizations performed before a match:

         floating `bc' at 0..2147483647 (checking floating) minlen 2
         Guessing start of match, REx `a*b+c' against `abc'...
         Found floating substr `bc' at offset 1...
         Guessed: match at offset 0

     Then the match is executed and the remaining lines describe
     the process:

         Matching REx `a*b+c' against `abc'
           Setting an EVAL scope, savestack=3
            0 <> <abc>             |  1:  STAR
                                    EXACT <a> can match 1 times out of 32767...
           Setting an EVAL scope, savestack=3
            1 <a> <bc>             |  4:    PLUS
                                    EXACT <b> can match 1 times out of 32767...
           Setting an EVAL scope, savestack=3
            2 <ab> <c>             |  7:      EXACT <c>
            3 <abc> <>             |  9:      END
         Match successful!
         Freeing REx: `a*b+c'

     Each step is of the form "n <x> <y>", with "<x>" the part of
     the string matched and "<y>" the part not yet matched.  The
     "|  1:  STAR" says that Perl is at line number 1 n the
     compilation list above.  See "Debugging regular expressions"
     in perldebguts for much more detail.

     An alternative method of debugging regexps is to embed
     "print" statements within the regexp.  This provides a blow-
     by-blow account of the backtracking in an alternation:

         "that this" =~ m@(?{print "Start at position ", pos, "\n";})
                          t(?{print "t1\n";})
                          h(?{print "h1\n";})
                          i(?{print "i1\n";})
                          s(?{print "s1\n";})
                              |
                          t(?{print "t2\n";})
                          h(?{print "h2\n";})
                          a(?{print "a2\n";})
                          t(?{print "t2\n";})
                          (?{print "Done at position ", pos, "\n";})
                         @x;

     prints





perl v5.12.5         Last change: 2012-11-03                   55






Perl Programmers Reference Guide                     PERLRETUT(1)



         Start at position 0
         t1
         h1
         t2
         h2
         a2
         t2
         Done at position 4

BUGS
     Code expressions, conditional expressions, and independent
     expressions are experimental.  Don't use them in production
     code.  Yet.


ATTRIBUTES
     See attributes(5) for descriptions of the following
     attributes:

     +---------------+------------------+
     |ATTRIBUTE TYPE | ATTRIBUTE VALUE  |
     +---------------+------------------+
     |Availability   | runtime/perl-512 |
     +---------------+------------------+
     |Stability      | Uncommitted      |
     +---------------+------------------+
SEE ALSO
     This is just a tutorial.  For the full story on Perl regular
     expressions, see the perlre regular expressions reference
     page.

     For more information on the matching "m//" and substitution
     "s///" operators, see "Regexp Quote-Like Operators" in
     perlop.  For information on the "split" operation, see
     "split" in perlfunc.

     For an excellent all-around resource on the care and feeding
     of regular expressions, see the book Mastering Regular
     Expressions by Jeffrey Friedl (published by O'Reilly, ISBN
     1556592-257-3).

AUTHOR AND COPYRIGHT
     Copyright (c) 2000 Mark Kvale All rights reserved.

     This document may be distributed under the same terms as
     Perl itself.

  Acknowledgments
     The inspiration for the stop codon DNA example came from the
     ZIP code example in chapter 7 of Mastering Regular
     Expressions.




perl v5.12.5         Last change: 2012-11-03                   56






Perl Programmers Reference Guide                     PERLRETUT(1)



     The author would like to thank Jeff Pinyan, Andrew Johnson,
     Peter Haworth, Ronald J Kimball, and Joe Smith for all their
     helpful comments.



NOTES
     This software was built from source available at
     https://java.net/projects/solaris-userland.  The original
     community source was downloaded from
     http://www.cpan.org/src/5.0/perl-5.12.5.tar.bz2

     Further information about this software can be found on the
     open source community website at http://www.perl.org/.









































perl v5.12.5         Last change: 2012-11-03                   57