perlretut
(1)
名前
perlretut - Perl regular expressions tutorial
形式
Please see following description for synopsis
説明
Perl Programmers Reference Guide PERLRETUT(1)
NAME
perlretut - Perl regular expressions tutorial
DESCRIPTION
This page provides a basic tutorial on understanding,
creating and using regular expressions in Perl. It serves
as a complement to the reference page on regular expressions
perlre. Regular expressions are an integral part of the
"m//", "s///", "qr//" and "split" operators and so this
tutorial also overlaps with "Regexp Quote-Like Operators" in
perlop and "split" in perlfunc.
Perl is widely renowned for excellence in text processing,
and regular expressions are one of the big factors behind
this fame. Perl regular expressions display an efficiency
and flexibility unknown in most other computer languages.
Mastering even the basics of regular expressions will allow
you to manipulate text with surprising ease.
What is a regular expression? A regular expression is
simply a string that describes a pattern. Patterns are in
common use these days; examples are the patterns typed into
a search engine to find web pages and the patterns used to
list files in a directory, e.g., "ls *.txt" or "dir *.*".
In Perl, the patterns described by regular expressions are
used to search strings, extract desired parts of strings,
and to do search and replace operations.
Regular expressions have the undeserved reputation of being
abstract and difficult to understand. Regular expressions
are constructed using simple concepts like conditionals and
loops and are no more difficult to understand than the
corresponding "if" conditionals and "while" loops in the
Perl language itself. In fact, the main challenge in
learning regular expressions is just getting used to the
terse notation used to express these concepts.
This tutorial flattens the learning curve by discussing
regular expression concepts, along with their notation, one
at a time and with many examples. The first part of the
tutorial will progress from the simplest word searches to
the basic regular expression concepts. If you master the
first part, you will have all the tools needed to solve
about 98% of your needs. The second part of the tutorial is
for those comfortable with the basics and hungry for more
power tools. It discusses the more advanced regular
expression operators and introduces the latest cutting edge
innovations in 5.6.0.
A note: to save time, 'regular expression' is often
abbreviated as regexp or regex. Regexp is a more natural
abbreviation than regex, but is harder to pronounce. The
perl v5.12.5 Last change: 2012-11-03 1
Perl Programmers Reference Guide PERLRETUT(1)
Perl pod documentation is evenly split on regexp vs regex;
in Perl, there is more than one way to abbreviate it. We'll
use regexp in this tutorial.
Part 1: The basics
Simple word matching
The simplest regexp is simply a word, or more generally, a
string of characters. A regexp consisting of a word matches
any string that contains that word:
"Hello World" =~ /World/; # matches
What is this Perl statement all about? "Hello World" is a
simple double quoted string. "World" is the regular
expression and the "//" enclosing "/World/" tells Perl to
search a string for a match. The operator "=~" associates
the string with the regexp match and produces a true value
if the regexp matched, or false if the regexp did not match.
In our case, "World" matches the second word in "Hello
World", so the expression is true. Expressions like this
are useful in conditionals:
if ("Hello World" =~ /World/) {
print "It matches\n";
}
else {
print "It doesn't match\n";
}
There are useful variations on this theme. The sense of the
match can be reversed by using the "!~" operator:
if ("Hello World" !~ /World/) {
print "It doesn't match\n";
}
else {
print "It matches\n";
}
The literal string in the regexp can be replaced by a
variable:
$greeting = "World";
if ("Hello World" =~ /$greeting/) {
print "It matches\n";
}
else {
print "It doesn't match\n";
}
If you're matching against the special default variable $_,
the "$_ =~" part can be omitted:
perl v5.12.5 Last change: 2012-11-03 2
Perl Programmers Reference Guide PERLRETUT(1)
$_ = "Hello World";
if (/World/) {
print "It matches\n";
}
else {
print "It doesn't match\n";
}
And finally, the "//" default delimiters for a match can be
changed to arbitrary delimiters by putting an 'm' out front:
"Hello World" =~ m!World!; # matches, delimited by '!'
"Hello World" =~ m{World}; # matches, note the matching '{}'
"/usr/bin/perl" =~ m"/perl"; # matches after '/usr/bin',
# '/' becomes an ordinary char
"/World/", "m!World!", and "m{World}" all represent the same
thing. When, e.g., the quote (""") is used as a delimiter,
the forward slash '/' becomes an ordinary character and can
be used in this regexp without trouble.
Let's consider how different regexps would match "Hello
World":
"Hello World" =~ /world/; # doesn't match
"Hello World" =~ /o W/; # matches
"Hello World" =~ /oW/; # doesn't match
"Hello World" =~ /World /; # doesn't match
The first regexp "world" doesn't match because regexps are
case-sensitive. The second regexp matches because the
substring 'o W' occurs in the string "Hello World". The
space character ' ' is treated like any other character in a
regexp and is needed to match in this case. The lack of a
space character is the reason the third regexp 'oW' doesn't
match. The fourth regexp 'World ' doesn't match because
there is a space at the end of the regexp, but not at the
end of the string. The lesson here is that regexps must
match a part of the string exactly in order for the
statement to be true.
If a regexp matches in more than one place in the string,
Perl will always match at the earliest possible point in the
string:
"Hello World" =~ /o/; # matches 'o' in 'Hello'
"That hat is red" =~ /hat/; # matches 'hat' in 'That'
With respect to character matching, there are a few more
points you need to know about. First of all, not all
characters can be used 'as is' in a match. Some characters,
called metacharacters, are reserved for use in regexp
perl v5.12.5 Last change: 2012-11-03 3
Perl Programmers Reference Guide PERLRETUT(1)
notation. The metacharacters are
{}[]()^$.|*+?\
The significance of each of these will be explained in the
rest of the tutorial, but for now, it is important only to
know that a metacharacter can be matched by putting a
backslash before it:
"2+2=4" =~ /2+2/; # doesn't match, + is a metacharacter
"2+2=4" =~ /2\+2/; # matches, \+ is treated like an ordinary +
"The interval is [0,1)." =~ /[0,1)./ # is a syntax error!
"The interval is [0,1)." =~ /\[0,1\)\./ # matches
"#!/usr/bin/perl" =~ /#!\/usr\/bin\/perl/; # matches
In the last regexp, the forward slash '/' is also
backslashed, because it is used to delimit the regexp. This
can lead to LTS (leaning toothpick syndrome), however, and
it is often more readable to change delimiters.
"#!/usr/bin/perl" =~ m!#\!/usr/bin/perl!; # easier to read
The backslash character '\' is a metacharacter itself and
needs to be backslashed:
'C:\WIN32' =~ /C:\\WIN/; # matches
In addition to the metacharacters, there are some ASCII
characters which don't have printable character equivalents
and are instead represented by escape sequences. Common
examples are "\t" for a tab, "\n" for a newline, "\r" for a
carriage return and "\a" for a bell. If your string is
better thought of as a sequence of arbitrary bytes, the
octal escape sequence, e.g., "\033", or hexadecimal escape
sequence, e.g., "\x1B" may be a more natural representation
for your bytes. Here are some examples of escapes:
"1000\t2000" =~ m(0\t2) # matches
"1000\n2000" =~ /0\n20/ # matches
"1000\t2000" =~ /\000\t2/ # doesn't match, "0" ne "\000"
"cat" =~ /\143\x61\x74/ # matches in ASCII, but a weird way to spell cat
If you've been around Perl a while, all this talk of escape
sequences may seem familiar. Similar escape sequences are
used in double-quoted strings and in fact the regexps in
Perl are mostly treated as double-quoted strings. This
means that variables can be used in regexps as well. Just
like double-quoted strings, the values of the variables in
the regexp will be substituted in before the regexp is
evaluated for matching purposes. So we have:
perl v5.12.5 Last change: 2012-11-03 4
Perl Programmers Reference Guide PERLRETUT(1)
$foo = 'house';
'housecat' =~ /$foo/; # matches
'cathouse' =~ /cat$foo/; # matches
'housecat' =~ /${foo}cat/; # matches
So far, so good. With the knowledge above you can already
perform searches with just about any literal string regexp
you can dream up. Here is a very simple emulation of the
Unix grep program:
% cat > simple_grep
#!/usr/bin/perl
$regexp = shift;
while (<>) {
print if /$regexp/;
}
^D
% chmod +x simple_grep
% simple_grep abba /usr/dict/words
Babbage
cabbage
cabbages
sabbath
Sabbathize
Sabbathizes
sabbatical
scabbard
scabbards
This program is easy to understand. "#!/usr/bin/perl" is
the standard way to invoke a perl program from the shell.
"$regexp = shift;" saves the first command line argument as
the regexp to be used, leaving the rest of the command line
arguments to be treated as files. "while (<>)" loops over
all the lines in all the files. For each line,
"print if /$regexp/;" prints the line if the regexp matches
the line. In this line, both "print" and "/$regexp/" use
the default variable $_ implicitly.
With all of the regexps above, if the regexp matched
anywhere in the string, it was considered a match.
Sometimes, however, we'd like to specify where in the string
the regexp should try to match. To do this, we would use
the anchor metacharacters "^" and "$". The anchor "^" means
match at the beginning of the string and the anchor "$"
means match at the end of the string, or before a newline at
the end of the string. Here is how they are used:
perl v5.12.5 Last change: 2012-11-03 5
Perl Programmers Reference Guide PERLRETUT(1)
"housekeeper" =~ /keeper/; # matches
"housekeeper" =~ /^keeper/; # doesn't match
"housekeeper" =~ /keeper$/; # matches
"housekeeper\n" =~ /keeper$/; # matches
The second regexp doesn't match because "^" constrains
"keeper" to match only at the beginning of the string, but
"housekeeper" has keeper starting in the middle. The third
regexp does match, since the "$" constrains "keeper" to
match only at the end of the string.
When both "^" and "$" are used at the same time, the regexp
has to match both the beginning and the end of the string,
i.e., the regexp matches the whole string. Consider
"keeper" =~ /^keep$/; # doesn't match
"keeper" =~ /^keeper$/; # matches
"" =~ /^$/; # ^$ matches an empty string
The first regexp doesn't match because the string has more
to it than "keep". Since the second regexp is exactly the
string, it matches. Using both "^" and "$" in a regexp
forces the complete string to match, so it gives you
complete control over which strings match and which don't.
Suppose you are looking for a fellow named bert, off in a
string by himself:
"dogbert" =~ /bert/; # matches, but not what you want
"dilbert" =~ /^bert/; # doesn't match, but ..
"bertram" =~ /^bert/; # matches, so still not good enough
"bertram" =~ /^bert$/; # doesn't match, good
"dilbert" =~ /^bert$/; # doesn't match, good
"bert" =~ /^bert$/; # matches, perfect
Of course, in the case of a literal string, one could just
as easily use the string comparison "$string eq 'bert'" and
it would be more efficient. The "^...$" regexp really
becomes useful when we add in the more powerful regexp tools
below.
Using character classes
Although one can already do quite a lot with the literal
string regexps above, we've only scratched the surface of
regular expression technology. In this and subsequent
sections we will introduce regexp concepts (and associated
metacharacter notations) that will allow a regexp to not
just represent a single character sequence, but a whole
class of them.
perl v5.12.5 Last change: 2012-11-03 6
Perl Programmers Reference Guide PERLRETUT(1)
One such concept is that of a character class. A character
class allows a set of possible characters, rather than just
a single character, to match at a particular point in a
regexp. Character classes are denoted by brackets "[...]",
with the set of characters to be possibly matched inside.
Here are some examples:
/cat/; # matches 'cat'
/[bcr]at/; # matches 'bat, 'cat', or 'rat'
/item[0123456789]/; # matches 'item0' or ... or 'item9'
"abc" =~ /[cab]/; # matches 'a'
In the last statement, even though 'c' is the first
character in the class, 'a' matches because the first
character position in the string is the earliest point at
which the regexp can match.
/[yY][eE][sS]/; # match 'yes' in a case-insensitive way
# 'yes', 'Yes', 'YES', etc.
This regexp displays a common task: perform a case-
insensitive match. Perl provides a way of avoiding all
those brackets by simply appending an 'i' to the end of the
match. Then "/[yY][eE][sS]/;" can be rewritten as
"/yes/i;". The 'i' stands for case-insensitive and is an
example of a modifier of the matching operation. We will
meet other modifiers later in the tutorial.
We saw in the section above that there were ordinary
characters, which represented themselves, and special
characters, which needed a backslash "\" to represent
themselves. The same is true in a character class, but the
sets of ordinary and special characters inside a character
class are different than those outside a character class.
The special characters for a character class are "-]\^$"
(and the pattern delimiter, whatever it is). "]" is special
because it denotes the end of a character class. "$" is
special because it denotes a scalar variable. "\" is
special because it is used in escape sequences, just like
above. Here is how the special characters "]$\" are
handled:
/[\]c]def/; # matches ']def' or 'cdef'
$x = 'bcr';
/[$x]at/; # matches 'bat', 'cat', or 'rat'
/[\$x]at/; # matches '$at' or 'xat'
/[\\$x]at/; # matches '\at', 'bat, 'cat', or 'rat'
The last two are a little tricky. In "[\$x]", the backslash
protects the dollar sign, so the character class has two
members "$" and "x". In "[\\$x]", the backslash is
protected, so $x is treated as a variable and substituted in
perl v5.12.5 Last change: 2012-11-03 7
Perl Programmers Reference Guide PERLRETUT(1)
double quote fashion.
The special character '-' acts as a range operator within
character classes, so that a contiguous set of characters
can be written as a range. With ranges, the unwieldy
"[0123456789]" and "[abc...xyz]" become the svelte "[0-9]"
and "[a-z]". Some examples are
/item[0-9]/; # matches 'item0' or ... or 'item9'
/[0-9bx-z]aa/; # matches '0aa', ..., '9aa',
# 'baa', 'xaa', 'yaa', or 'zaa'
/[0-9a-fA-F]/; # matches a hexadecimal digit
/[0-9a-zA-Z_]/; # matches a "word" character,
# like those in a Perl variable name
If '-' is the first or last character in a character class,
it is treated as an ordinary character; "[-ab]", "[ab-]" and
"[a\-b]" are all equivalent.
The special character "^" in the first position of a
character class denotes a negated character class, which
matches any character but those in the brackets. Both
"[...]" and "[^...]" must match a character, or the match
fails. Then
/[^a]at/; # doesn't match 'aat' or 'at', but matches
# all other 'bat', 'cat, '0at', '%at', etc.
/[^0-9]/; # matches a non-numeric character
/[a^]at/; # matches 'aat' or '^at'; here '^' is ordinary
Now, even "[0-9]" can be a bother to write multiple times,
so in the interest of saving keystrokes and making regexps
more readable, Perl has several abbreviations for common
character classes, as shown below. Since the introduction
of Unicode, these character classes match more than just a
few characters in the ISO 8859-1 range.
o \d matches a digit, not just [0-9] but also digits from
non-roman scripts
o \s matches a whitespace character, the set [\ \t\r\n\f]
and others
o \w matches a word character (alphanumeric or _), not
just [0-9a-zA-Z_] but also digits and characters from
non-roman scripts
o \D is a negated \d; it represents any other character
than a digit, or [^\d]
o \S is a negated \s; it represents any non-whitespace
character [^\s]
perl v5.12.5 Last change: 2012-11-03 8
Perl Programmers Reference Guide PERLRETUT(1)
o \W is a negated \w; it represents any non-word character
[^\w]
o The period '.' matches any character but "\n" (unless
the modifier "//s" is in effect, as explained below).
The "\d\s\w\D\S\W" abbreviations can be used both inside and
outside of character classes. Here are some in use:
/\d\d:\d\d:\d\d/; # matches a hh:mm:ss time format
/[\d\s]/; # matches any digit or whitespace character
/\w\W\w/; # matches a word char, followed by a
# non-word char, followed by a word char
/..rt/; # matches any two chars, followed by 'rt'
/end\./; # matches 'end.'
/end[.]/; # same thing, matches 'end.'
Because a period is a metacharacter, it needs to be escaped
to match as an ordinary period. Because, for example, "\d"
and "\w" are sets of characters, it is incorrect to think of
"[^\d\w]" as "[\D\W]"; in fact "[^\d\w]" is the same as
"[^\w]", which is the same as "[\W]". Think DeMorgan's laws.
An anchor useful in basic regexps is the word anchor "\b".
This matches a boundary between a word character and a non-
word character "\w\W" or "\W\w":
$x = "Housecat catenates house and cat";
$x =~ /cat/; # matches cat in 'housecat'
$x =~ /\bcat/; # matches cat in 'catenates'
$x =~ /cat\b/; # matches cat in 'housecat'
$x =~ /\bcat\b/; # matches 'cat' at end of string
Note in the last example, the end of the string is
considered a word boundary.
You might wonder why '.' matches everything but "\n" - why
not every character? The reason is that often one is
matching against lines and would like to ignore the newline
characters. For instance, while the string "\n" represents
one line, we would like to think of it as empty. Then
"" =~ /^$/; # matches
"\n" =~ /^$/; # matches, $ anchors before "\n"
"" =~ /./; # doesn't match; it needs a char
"" =~ /^.$/; # doesn't match; it needs a char
"\n" =~ /^.$/; # doesn't match; it needs a char other than "\n"
"a" =~ /^.$/; # matches
"a\n" =~ /^.$/; # matches, $ anchors before "\n"
perl v5.12.5 Last change: 2012-11-03 9
Perl Programmers Reference Guide PERLRETUT(1)
This behavior is convenient, because we usually want to
ignore newlines when we count and match characters in a
line. Sometimes, however, we want to keep track of
newlines. We might even want "^" and "$" to anchor at the
beginning and end of lines within the string, rather than
just the beginning and end of the string. Perl allows us to
choose between ignoring and paying attention to newlines by
using the "//s" and "//m" modifiers. "//s" and "//m" stand
for single line and multi-line and they determine whether a
string is to be treated as one continuous string, or as a
set of lines. The two modifiers affect two aspects of how
the regexp is interpreted: 1) how the '.' character class is
defined, and 2) where the anchors "^" and "$" are able to
match. Here are the four possible combinations:
o no modifiers (//): Default behavior. '.' matches any
character except "\n". "^" matches only at the
beginning of the string and "$" matches only at the end
or before a newline at the end.
o s modifier (//s): Treat string as a single long line.
'.' matches any character, even "\n". "^" matches only
at the beginning of the string and "$" matches only at
the end or before a newline at the end.
o m modifier (//m): Treat string as a set of multiple
lines. '.' matches any character except "\n". "^" and
"$" are able to match at the start or end of any line
within the string.
o both s and m modifiers (//sm): Treat string as a single
long line, but detect multiple lines. '.' matches any
character, even "\n". "^" and "$", however, are able to
match at the start or end of any line within the string.
Here are examples of "//s" and "//m" in action:
$x = "There once was a girl\nWho programmed in Perl\n";
$x =~ /^Who/; # doesn't match, "Who" not at start of string
$x =~ /^Who/s; # doesn't match, "Who" not at start of string
$x =~ /^Who/m; # matches, "Who" at start of second line
$x =~ /^Who/sm; # matches, "Who" at start of second line
$x =~ /girl.Who/; # doesn't match, "." doesn't match "\n"
$x =~ /girl.Who/s; # matches, "." matches "\n"
$x =~ /girl.Who/m; # doesn't match, "." doesn't match "\n"
$x =~ /girl.Who/sm; # matches, "." matches "\n"
Most of the time, the default behavior is what is wanted,
but "//s" and "//m" are occasionally very useful. If "//m"
is being used, the start of the string can still be matched
perl v5.12.5 Last change: 2012-11-03 10
Perl Programmers Reference Guide PERLRETUT(1)
with "\A" and the end of the string can still be matched
with the anchors "\Z" (matches both the end and the newline
before, like "$"), and "\z" (matches only the end):
$x =~ /^Who/m; # matches, "Who" at start of second line
$x =~ /\AWho/m; # doesn't match, "Who" is not at start of string
$x =~ /girl$/m; # matches, "girl" at end of first line
$x =~ /girl\Z/m; # doesn't match, "girl" is not at end of string
$x =~ /Perl\Z/m; # matches, "Perl" is at newline before end
$x =~ /Perl\z/m; # doesn't match, "Perl" is not at end of string
We now know how to create choices among classes of
characters in a regexp. What about choices among words or
character strings? Such choices are described in the next
section.
Matching this or that
Sometimes we would like our regexp to be able to match
different possible words or character strings. This is
accomplished by using the alternation metacharacter "|". To
match "dog" or "cat", we form the regexp "dog|cat". As
before, Perl will try to match the regexp at the earliest
possible point in the string. At each character position,
Perl will first try to match the first alternative, "dog".
If "dog" doesn't match, Perl will then try the next
alternative, "cat". If "cat" doesn't match either, then the
match fails and Perl moves to the next position in the
string. Some examples:
"cats and dogs" =~ /cat|dog|bird/; # matches "cat"
"cats and dogs" =~ /dog|cat|bird/; # matches "cat"
Even though "dog" is the first alternative in the second
regexp, "cat" is able to match earlier in the string.
"cats" =~ /c|ca|cat|cats/; # matches "c"
"cats" =~ /cats|cat|ca|c/; # matches "cats"
Here, all the alternatives match at the first string
position, so the first alternative is the one that matches.
If some of the alternatives are truncations of the others,
put the longest ones first to give them a chance to match.
"cab" =~ /a|b|c/ # matches "c"
# /a|b|c/ == /[abc]/
The last example points out that character classes are like
alternations of characters. At a given character position,
the first alternative that allows the regexp match to
succeed will be the one that matches.
perl v5.12.5 Last change: 2012-11-03 11
Perl Programmers Reference Guide PERLRETUT(1)
Grouping things and hierarchical matching
Alternation allows a regexp to choose among alternatives,
but by itself it is unsatisfying. The reason is that each
alternative is a whole regexp, but sometime we want
alternatives for just part of a regexp. For instance,
suppose we want to search for housecats or housekeepers.
The regexp "housecat|housekeeper" fits the bill, but is
inefficient because we had to type "house" twice. It would
be nice to have parts of the regexp be constant, like
"house", and some parts have alternatives, like
"cat|keeper".
The grouping metacharacters "()" solve this problem.
Grouping allows parts of a regexp to be treated as a single
unit. Parts of a regexp are grouped by enclosing them in
parentheses. Thus we could solve the "housecat|housekeeper"
by forming the regexp as "house(cat|keeper)". The regexp
"house(cat|keeper)" means match "house" followed by either
"cat" or "keeper". Some more examples are
/(a|b)b/; # matches 'ab' or 'bb'
/(ac|b)b/; # matches 'acb' or 'bb'
/(^a|b)c/; # matches 'ac' at start of string or 'bc' anywhere
/(a|[bc])d/; # matches 'ad', 'bd', or 'cd'
/house(cat|)/; # matches either 'housecat' or 'house'
/house(cat(s|)|)/; # matches either 'housecats' or 'housecat' or
# 'house'. Note groups can be nested.
/(19|20|)\d\d/; # match years 19xx, 20xx, or the Y2K problem, xx
"20" =~ /(19|20|)\d\d/; # matches the null alternative '()\d\d',
# because '20\d\d' can't match
Alternations behave the same way in groups as out of them:
at a given string position, the leftmost alternative that
allows the regexp to match is taken. So in the last example
at the first string position, "20" matches the second
alternative, but there is nothing left over to match the
next two digits "\d\d". So Perl moves on to the next
alternative, which is the null alternative and that works,
since "20" is two digits.
The process of trying one alternative, seeing if it matches,
and moving on to the next alternative, while going back in
the string from where the previous alternative was tried, if
it doesn't, is called backtracking. The term 'backtracking'
comes from the idea that matching a regexp is like a walk in
the woods. Successfully matching a regexp is like arriving
at a destination. There are many possible trailheads, one
for each string position, and each one is tried in order,
left to right. From each trailhead there may be many paths,
some of which get you there, and some which are dead ends.
perl v5.12.5 Last change: 2012-11-03 12
Perl Programmers Reference Guide PERLRETUT(1)
When you walk along a trail and hit a dead end, you have to
backtrack along the trail to an earlier point to try another
trail. If you hit your destination, you stop immediately
and forget about trying all the other trails. You are
persistent, and only if you have tried all the trails from
all the trailheads and not arrived at your destination, do
you declare failure. To be concrete, here is a step-by-step
analysis of what Perl does when it tries to match the regexp
"abcde" =~ /(abd|abc)(df|d|de)/;
0 Start with the first letter in the string 'a'.
1 Try the first alternative in the first group 'abd'.
2 Match 'a' followed by 'b'. So far so good.
3 'd' in the regexp doesn't match 'c' in the string - a
dead end. So backtrack two characters and pick the
second alternative in the first group 'abc'.
4 Match 'a' followed by 'b' followed by 'c'. We are on a
roll and have satisfied the first group. Set $1 to
'abc'.
5 Move on to the second group and pick the first
alternative 'df'.
6 Match the 'd'.
7 'f' in the regexp doesn't match 'e' in the string, so a
dead end. Backtrack one character and pick the second
alternative in the second group 'd'.
8 'd' matches. The second grouping is satisfied, so set $2
to 'd'.
9 We are at the end of the regexp, so we are done! We have
matched 'abcd' out of the string "abcde".
There are a couple of things to note about this analysis.
First, the third alternative in the second group 'de' also
allows a match, but we stopped before we got to it - at a
given character position, leftmost wins. Second, we were
able to get a match at the first character position of the
string 'a'. If there were no matches at the first position,
Perl would move to the second character position 'b' and
attempt the match all over again. Only when all possible
paths at all possible character positions have been
exhausted does Perl give up and declare
"$string =~ /(abd|abc)(df|d|de)/;" to be false.
perl v5.12.5 Last change: 2012-11-03 13
Perl Programmers Reference Guide PERLRETUT(1)
Even with all this work, regexp matching happens remarkably
fast. To speed things up, Perl compiles the regexp into a
compact sequence of opcodes that can often fit inside a
processor cache. When the code is executed, these opcodes
can then run at full throttle and search very quickly.
Extracting matches
The grouping metacharacters "()" also serve another
completely different function: they allow the extraction of
the parts of a string that matched. This is very useful to
find out what matched and for text processing in general.
For each grouping, the part that matched inside goes into
the special variables $1, $2, etc. They can be used just as
ordinary variables:
# extract hours, minutes, seconds
if ($time =~ /(\d\d):(\d\d):(\d\d)/) { # match hh:mm:ss format
$hours = $1;
$minutes = $2;
$seconds = $3;
}
Now, we know that in scalar context,
"$time =~ /(\d\d):(\d\d):(\d\d)/" returns a true or false
value. In list context, however, it returns the list of
matched values "($1,$2,$3)". So we could write the code
more compactly as
# extract hours, minutes, seconds
($hours, $minutes, $second) = ($time =~ /(\d\d):(\d\d):(\d\d)/);
If the groupings in a regexp are nested, $1 gets the group
with the leftmost opening parenthesis, $2 the next opening
parenthesis, etc. Here is a regexp with nested groups:
/(ab(cd|ef)((gi)|j))/;
1 2 34
If this regexp matches, $1 contains a string starting with
'ab', $2 is either set to 'cd' or 'ef', $3 equals either
'gi' or 'j', and $4 is either set to 'gi', just like $3, or
it remains undefined.
For convenience, Perl sets $+ to the string held by the
highest numbered $1, $2,... that got assigned (and, somewhat
related, $^N to the value of the $1, $2,... most-recently
assigned; i.e. the $1, $2,... associated with the rightmost
closing parenthesis used in the match).
Backreferences
Closely associated with the matching variables $1, $2, ...
are the backreferences "\1", "\2",... Backreferences are
perl v5.12.5 Last change: 2012-11-03 14
Perl Programmers Reference Guide PERLRETUT(1)
simply matching variables that can be used inside a regexp.
This is a really nice feature; what matches later in a
regexp is made to depend on what matched earlier in the
regexp. Suppose we wanted to look for doubled words in a
text, like 'the the'. The following regexp finds all
3-letter doubles with a space in between:
/\b(\w\w\w)\s\1\b/;
The grouping assigns a value to \1, so that the same 3
letter sequence is used for both parts.
A similar task is to find words consisting of two identical
parts:
% simple_grep '^(\w\w\w\w|\w\w\w|\w\w|\w)\1$' /usr/dict/words
beriberi
booboo
coco
mama
murmur
papa
The regexp has a single grouping which considers 4-letter
combinations, then 3-letter combinations, etc., and uses
"\1" to look for a repeat. Although $1 and "\1" represent
the same thing, care should be taken to use matched
variables $1, $2,... only outside a regexp and
backreferences "\1", "\2",... only inside a regexp; not
doing so may lead to surprising and unsatisfactory results.
Relative backreferences
Counting the opening parentheses to get the correct number
for a backreference is errorprone as soon as there is more
than one capturing group. A more convenient technique
became available with Perl 5.10: relative backreferences. To
refer to the immediately preceding capture group one now may
write "\g{-1}", the next but last is available via "\g{-2}",
and so on.
Another good reason in addition to readability and
maintainability for using relative backreferences is
illustrated by the following example, where a simple pattern
for matching peculiar strings is used:
$a99a = '([a-z])(\d)\2\1'; # matches a11a, g22g, x33x, etc.
Now that we have this pattern stored as a handy string, we
might feel tempted to use it as a part of some other
pattern:
perl v5.12.5 Last change: 2012-11-03 15
Perl Programmers Reference Guide PERLRETUT(1)
$line = "code=e99e";
if ($line =~ /^(\w+)=$a99a$/){ # unexpected behavior!
print "$1 is valid\n";
} else {
print "bad line: '$line'\n";
}
But this doesn't match, at least not the way one might
expect. Only after inserting the interpolated $a99a and
looking at the resulting full text of the regexp is it
obvious that the backreferences have backfired. The
subexpression "(\w+)" has snatched number 1 and demoted the
groups in $a99a by one rank. This can be avoided by using
relative backreferences:
$a99a = '([a-z])(\d)\g{-1}\g{-2}'; # safe for being interpolated
Named backreferences
Perl 5.10 also introduced named capture buffers and named
backreferences. To attach a name to a capturing group, you
write either "(?<name>...)" or "(?'name'...)". The
backreference may then be written as "\g{name}". It is
permissible to attach the same name to more than one group,
but then only the leftmost one of the eponymous set can be
referenced. Outside of the pattern a named capture buffer
is accessible through the "%+" hash.
Assuming that we have to match calendar dates which may be
given in one of the three formats yyyy-mm-dd, mm/dd/yyyy or
dd.mm.yyyy, we can write three suitable patterns where we
use 'd', 'm' and 'y' respectively as the names of the
buffers capturing the pertaining components of a date. The
matching operation combines the three patterns as
alternatives:
$fmt1 = '(?<y>\d\d\d\d)-(?<m>\d\d)-(?<d>\d\d)';
$fmt2 = '(?<m>\d\d)/(?<d>\d\d)/(?<y>\d\d\d\d)';
$fmt3 = '(?<d>\d\d)\.(?<m>\d\d)\.(?<y>\d\d\d\d)';
for my $d qw( 2006-10-21 15.01.2007 10/31/2005 ){
if ( $d =~ m{$fmt1|$fmt2|$fmt3} ){
print "day=$+{d} month=$+{m} year=$+{y}\n";
}
}
If any of the alternatives matches, the hash "%+" is bound
to contain the three key-value pairs.
Alternative capture group numbering
Yet another capturing group numbering technique (also as
from Perl 5.10) deals with the problem of referring to
groups within a set of alternatives. Consider a pattern for
matching a time of the day, civil or military style:
perl v5.12.5 Last change: 2012-11-03 16
Perl Programmers Reference Guide PERLRETUT(1)
if ( $time =~ /(\d\d|\d):(\d\d)|(\d\d)(\d\d)/ ){
# process hour and minute
}
Processing the results requires an additional if statement
to determine whether $1 and $2 or $3 and $4 contain the
goodies. It would be easier if we could use buffer numbers 1
and 2 in second alternative as well, and this is exactly
what the parenthesized construct "(?|...)", set around an
alternative achieves. Here is an extended version of the
previous pattern:
if ( $time =~ /(?|(\d\d|\d):(\d\d)|(\d\d)(\d\d))\s+([A-Z][A-Z][A-Z])/ ){
print "hour=$1 minute=$2 zone=$3\n";
}
Within the alternative numbering group, buffer numbers start
at the same position for each alternative. After the group,
numbering continues with one higher than the maximum reached
across all the alternatives.
Position information
In addition to what was matched, Perl (since 5.6.0) also
provides the positions of what was matched as contents of
the "@-" and "@+" arrays. "$-[0]" is the position of the
start of the entire match and $+[0] is the position of the
end. Similarly, "$-[n]" is the position of the start of the
$n match and $+[n] is the position of the end. If $n is
undefined, so are "$-[n]" and $+[n]. Then this code
$x = "Mmm...donut, thought Homer";
$x =~ /^(Mmm|Yech)\.\.\.(donut|peas)/; # matches
foreach $expr (1..$#-) {
print "Match $expr: '${$expr}' at position ($-[$expr],$+[$expr])\n";
}
prints
Match 1: 'Mmm' at position (0,3)
Match 2: 'donut' at position (6,11)
Even if there are no groupings in a regexp, it is still
possible to find out what exactly matched in a string. If
you use them, Perl will set "$`" to the part of the string
before the match, will set $& to the part of the string that
matched, and will set "$'" to the part of the string after
the match. An example:
$x = "the cat caught the mouse";
$x =~ /cat/; # $` = 'the ', $& = 'cat', $' = ' caught the mouse'
$x =~ /the/; # $` = '', $& = 'the', $' = ' cat caught the mouse'
perl v5.12.5 Last change: 2012-11-03 17
Perl Programmers Reference Guide PERLRETUT(1)
In the second match, "$`" equals '' because the regexp
matched at the first character position in the string and
stopped; it never saw the second 'the'. It is important to
note that using "$`" and "$'" slows down regexp matching
quite a bit, while $& slows it down to a lesser extent,
because if they are used in one regexp in a program, they
are generated for all regexps in the program. So if raw
performance is a goal of your application, they should be
avoided. If you need to extract the corresponding
substrings, use "@-" and "@+" instead:
$` is the same as substr( $x, 0, $-[0] )
$& is the same as substr( $x, $-[0], $+[0]-$-[0] )
$' is the same as substr( $x, $+[0] )
Non-capturing groupings
A group that is required to bundle a set of alternatives may
or may not be useful as a capturing group. If it isn't, it
just creates a superfluous addition to the set of available
capture buffer values, inside as well as outside the regexp.
Non-capturing groupings, denoted by "(?:regexp)", still
allow the regexp to be treated as a single unit, but don't
establish a capturing buffer at the same time. Both
capturing and non-capturing groupings are allowed to co-
exist in the same regexp. Because there is no extraction,
non-capturing groupings are faster than capturing groupings.
Non-capturing groupings are also handy for choosing exactly
which parts of a regexp are to be extracted to matching
variables:
# match a number, $1-$4 are set, but we only want $1
/([+-]?\ *(\d+(\.\d*)?|\.\d+)([eE][+-]?\d+)?)/;
# match a number faster , only $1 is set
/([+-]?\ *(?:\d+(?:\.\d*)?|\.\d+)(?:[eE][+-]?\d+)?)/;
# match a number, get $1 = whole number, $2 = exponent
/([+-]?\ *(?:\d+(?:\.\d*)?|\.\d+)(?:[eE]([+-]?\d+))?)/;
Non-capturing groupings are also useful for removing
nuisance elements gathered from a split operation where
parentheses are required for some reason:
$x = '12aba34ba5';
@num = split /(a|b)+/, $x; # @num = ('12','a','34','b','5')
@num = split /(?:a|b)+/, $x; # @num = ('12','34','5')
Matching repetitions
The examples in the previous section display an annoying
weakness. We were only matching 3-letter words, or chunks
of words of 4 letters or less. We'd like to be able to
match words or, more generally, strings of any length,
perl v5.12.5 Last change: 2012-11-03 18
Perl Programmers Reference Guide PERLRETUT(1)
without writing out tedious alternatives like
"\w\w\w\w|\w\w\w|\w\w|\w".
This is exactly the problem the quantifier metacharacters
"?", "*", "+", and "{}" were created for. They allow us to
delimit the number of repeats for a portion of a regexp we
consider to be a match. Quantifiers are put immediately
after the character, character class, or grouping that we
want to specify. They have the following meanings:
o "a?" means: match 'a' 1 or 0 times
o "a*" means: match 'a' 0 or more times, i.e., any number
of times
o "a+" means: match 'a' 1 or more times, i.e., at least
once
o "a{n,m}" means: match at least "n" times, but not more
than "m" times.
o "a{n,}" means: match at least "n" or more times
o "a{n}" means: match exactly "n" times
Here are some examples:
/[a-z]+\s+\d*/; # match a lowercase word, at least one space, and
# any number of digits
/(\w+)\s+\1/; # match doubled words of arbitrary length
/y(es)?/i; # matches 'y', 'Y', or a case-insensitive 'yes'
$year =~ /\d{2,4}/; # make sure year is at least 2 but not more
# than 4 digits
$year =~ /\d{4}|\d{2}/; # better match; throw out 3 digit dates
$year =~ /\d{2}(\d{2})?/; # same thing written differently. However,
# this produces $1 and the other does not.
% simple_grep '^(\w+)\1$' /usr/dict/words # isn't this easier?
beriberi
booboo
coco
mama
murmur
papa
For all of these quantifiers, Perl will try to match as much
of the string as possible, while still allowing the regexp
to succeed. Thus with "/a?.../", Perl will first try to
match the regexp with the "a" present; if that fails, Perl
will try to match the regexp without the "a" present. For
the quantifier "*", we get the following:
perl v5.12.5 Last change: 2012-11-03 19
Perl Programmers Reference Guide PERLRETUT(1)
$x = "the cat in the hat";
$x =~ /^(.*)(cat)(.*)$/; # matches,
# $1 = 'the '
# $2 = 'cat'
# $3 = ' in the hat'
Which is what we might expect, the match finds the only
"cat" in the string and locks onto it. Consider, however,
this regexp:
$x =~ /^(.*)(at)(.*)$/; # matches,
# $1 = 'the cat in the h'
# $2 = 'at'
# $3 = '' (0 characters match)
One might initially guess that Perl would find the "at" in
"cat" and stop there, but that wouldn't give the longest
possible string to the first quantifier ".*". Instead, the
first quantifier ".*" grabs as much of the string as
possible while still having the regexp match. In this
example, that means having the "at" sequence with the final
"at" in the string. The other important principle
illustrated here is that when there are two or more elements
in a regexp, the leftmost quantifier, if there is one, gets
to grab as much the string as possible, leaving the rest of
the regexp to fight over scraps. Thus in our example, the
first quantifier ".*" grabs most of the string, while the
second quantifier ".*" gets the empty string. Quantifiers
that grab as much of the string as possible are called
maximal match or greedy quantifiers.
When a regexp can match a string in several different ways,
we can use the principles above to predict which way the
regexp will match:
o Principle 0: Taken as a whole, any regexp will be
matched at the earliest possible position in the string.
o Principle 1: In an alternation "a|b|c...", the leftmost
alternative that allows a match for the whole regexp
will be the one used.
o Principle 2: The maximal matching quantifiers "?", "*",
"+" and "{n,m}" will in general match as much of the
string as possible while still allowing the whole regexp
to match.
o Principle 3: If there are two or more elements in a
regexp, the leftmost greedy quantifier, if any, will
match as much of the string as possible while still
allowing the whole regexp to match. The next leftmost
greedy quantifier, if any, will try to match as much of
perl v5.12.5 Last change: 2012-11-03 20
Perl Programmers Reference Guide PERLRETUT(1)
the string remaining available to it as possible, while
still allowing the whole regexp to match. And so on,
until all the regexp elements are satisfied.
As we have seen above, Principle 0 overrides the others. The
regexp will be matched as early as possible, with the other
principles determining how the regexp matches at that
earliest character position.
Here is an example of these principles in action:
$x = "The programming republic of Perl";
$x =~ /^(.+)(e|r)(.*)$/; # matches,
# $1 = 'The programming republic of Pe'
# $2 = 'r'
# $3 = 'l'
This regexp matches at the earliest string position, 'T'.
One might think that "e", being leftmost in the alternation,
would be matched, but "r" produces the longest string in the
first quantifier.
$x =~ /(m{1,2})(.*)$/; # matches,
# $1 = 'mm'
# $2 = 'ing republic of Perl'
Here, The earliest possible match is at the first 'm' in
"programming". "m{1,2}" is the first quantifier, so it gets
to match a maximal "mm".
$x =~ /.*(m{1,2})(.*)$/; # matches,
# $1 = 'm'
# $2 = 'ing republic of Perl'
Here, the regexp matches at the start of the string. The
first quantifier ".*" grabs as much as possible, leaving
just a single 'm' for the second quantifier "m{1,2}".
$x =~ /(.?)(m{1,2})(.*)$/; # matches,
# $1 = 'a'
# $2 = 'mm'
# $3 = 'ing republic of Perl'
Here, ".?" eats its maximal one character at the earliest
possible position in the string, 'a' in "programming",
leaving "m{1,2}" the opportunity to match both "m"'s.
Finally,
"aXXXb" =~ /(X*)/; # matches with $1 = ''
because it can match zero copies of 'X' at the beginning of
the string. If you definitely want to match at least one
perl v5.12.5 Last change: 2012-11-03 21
Perl Programmers Reference Guide PERLRETUT(1)
'X', use "X+", not "X*".
Sometimes greed is not good. At times, we would like
quantifiers to match a minimal piece of string, rather than
a maximal piece. For this purpose, Larry Wall created the
minimal match or non-greedy quantifiers "??", "*?", "+?",
and "{}?". These are the usual quantifiers with a "?"
appended to them. They have the following meanings:
o "a??" means: match 'a' 0 or 1 times. Try 0 first, then
1.
o "a*?" means: match 'a' 0 or more times, i.e., any number
of times, but as few times as possible
o "a+?" means: match 'a' 1 or more times, i.e., at least
once, but as few times as possible
o "a{n,m}?" means: match at least "n" times, not more than
"m" times, as few times as possible
o "a{n,}?" means: match at least "n" times, but as few
times as possible
o "a{n}?" means: match exactly "n" times. Because we
match exactly "n" times, "a{n}?" is equivalent to "a{n}"
and is just there for notational consistency.
Let's look at the example above, but with minimal
quantifiers:
$x = "The programming republic of Perl";
$x =~ /^(.+?)(e|r)(.*)$/; # matches,
# $1 = 'Th'
# $2 = 'e'
# $3 = ' programming republic of Perl'
The minimal string that will allow both the start of the
string "^" and the alternation to match is "Th", with the
alternation "e|r" matching "e". The second quantifier ".*"
is free to gobble up the rest of the string.
$x =~ /(m{1,2}?)(.*?)$/; # matches,
# $1 = 'm'
# $2 = 'ming republic of Perl'
The first string position that this regexp can match is at
the first 'm' in "programming". At this position, the
minimal "m{1,2}?" matches just one 'm'. Although the
second quantifier ".*?" would prefer to match no characters,
it is constrained by the end-of-string anchor "$" to match
the rest of the string.
perl v5.12.5 Last change: 2012-11-03 22
Perl Programmers Reference Guide PERLRETUT(1)
$x =~ /(.*?)(m{1,2}?)(.*)$/; # matches,
# $1 = 'The progra'
# $2 = 'm'
# $3 = 'ming republic of Perl'
In this regexp, you might expect the first minimal
quantifier ".*?" to match the empty string, because it is
not constrained by a "^" anchor to match the beginning of
the word. Principle 0 applies here, however. Because it is
possible for the whole regexp to match at the start of the
string, it will match at the start of the string. Thus the
first quantifier has to match everything up to the first
"m". The second minimal quantifier matches just one "m" and
the third quantifier matches the rest of the string.
$x =~ /(.??)(m{1,2})(.*)$/; # matches,
# $1 = 'a'
# $2 = 'mm'
# $3 = 'ing republic of Perl'
Just as in the previous regexp, the first quantifier ".??"
can match earliest at position 'a', so it does. The second
quantifier is greedy, so it matches "mm", and the third
matches the rest of the string.
We can modify principle 3 above to take into account non-
greedy quantifiers:
o Principle 3: If there are two or more elements in a
regexp, the leftmost greedy (non-greedy) quantifier, if
any, will match as much (little) of the string as
possible while still allowing the whole regexp to match.
The next leftmost greedy (non-greedy) quantifier, if
any, will try to match as much (little) of the string
remaining available to it as possible, while still
allowing the whole regexp to match. And so on, until
all the regexp elements are satisfied.
Just like alternation, quantifiers are also susceptible to
backtracking. Here is a step-by-step analysis of the
example
$x = "the cat in the hat";
$x =~ /^(.*)(at)(.*)$/; # matches,
# $1 = 'the cat in the h'
# $2 = 'at'
# $3 = '' (0 matches)
0 Start with the first letter in the string 't'.
1 The first quantifier '.*' starts out by matching the
whole string 'the cat in the hat'.
perl v5.12.5 Last change: 2012-11-03 23
Perl Programmers Reference Guide PERLRETUT(1)
2 'a' in the regexp element 'at' doesn't match the end of
the string. Backtrack one character.
3 'a' in the regexp element 'at' still doesn't match the
last letter of the string 't', so backtrack one more
character.
4 Now we can match the 'a' and the 't'.
5 Move on to the third element '.*'. Since we are at the
end of the string and '.*' can match 0 times, assign it
the empty string.
6 We are done!
Most of the time, all this moving forward and backtracking
happens quickly and searching is fast. There are some
pathological regexps, however, whose execution time
exponentially grows with the size of the string. A typical
structure that blows up in your face is of the form
/(a|b+)*/;
The problem is the nested indeterminate quantifiers. There
are many different ways of partitioning a string of length n
between the "+" and "*": one repetition with "b+" of length
n, two repetitions with the first "b+" length k and the
second with length n-k, m repetitions whose bits add up to
length n, etc. In fact there are an exponential number of
ways to partition a string as a function of its length. A
regexp may get lucky and match early in the process, but if
there is no match, Perl will try every possibility before
giving up. So be careful with nested "*"'s, "{n,m}"'s, and
"+"'s. The book Mastering Regular Expressions by Jeffrey
Friedl gives a wonderful discussion of this and other
efficiency issues.
Possessive quantifiers
Backtracking during the relentless search for a match may be
a waste of time, particularly when the match is bound to
fail. Consider the simple pattern
/^\w+\s+\w+$/; # a word, spaces, a word
Whenever this is applied to a string which doesn't quite
meet the pattern's expectations such as "abc " or
"abc def ", the regex engine will backtrack, approximately
once for each character in the string. But we know that
there is no way around taking all of the initial word
characters to match the first repetition, that all spaces
must be eaten by the middle part, and the same goes for the
second word.
perl v5.12.5 Last change: 2012-11-03 24
Perl Programmers Reference Guide PERLRETUT(1)
With the introduction of the possessive quantifiers in Perl
5.10, we have a way of instructing the regex engine not to
backtrack, with the usual quantifiers with a "+" appended to
them. This makes them greedy as well as stingy; once they
succeed they won't give anything back to permit another
solution. They have the following meanings:
o "a{n,m}+" means: match at least "n" times, not more than
"m" times, as many times as possible, and don't give
anything up. "a?+" is short for "a{0,1}+"
o "a{n,}+" means: match at least "n" times, but as many
times as possible, and don't give anything up. "a*+" is
short for "a{0,}+" and "a++" is short for "a{1,}+".
o "a{n}+" means: match exactly "n" times. It is just
there for notational consistency.
These possessive quantifiers represent a special case of a
more general concept, the independent subexpression, see
below.
As an example where a possessive quantifier is suitable we
consider matching a quoted string, as it appears in several
programming languages. The backslash is used as an escape
character that indicates that the next character is to be
taken literally, as another character for the string.
Therefore, after the opening quote, we expect a (possibly
empty) sequence of alternatives: either some character
except an unescaped quote or backslash or an escaped
character.
/"(?:[^"\\]++|\\.)*+"/;
Building a regexp
At this point, we have all the basic regexp concepts
covered, so let's give a more involved example of a regular
expression. We will build a regexp that matches numbers.
The first task in building a regexp is to decide what we
want to match and what we want to exclude. In our case, we
want to match both integers and floating point numbers and
we want to reject any string that isn't a number.
The next task is to break the problem down into smaller
problems that are easily converted into a regexp.
The simplest case is integers. These consist of a sequence
of digits, with an optional sign in front. The digits we
can represent with "\d+" and the sign can be matched with
"[+-]". Thus the integer regexp is
perl v5.12.5 Last change: 2012-11-03 25
Perl Programmers Reference Guide PERLRETUT(1)
/[+-]?\d+/; # matches integers
A floating point number potentially has a sign, an integral
part, a decimal point, a fractional part, and an exponent.
One or more of these parts is optional, so we need to check
out the different possibilities. Floating point numbers
which are in proper form include 123., 0.345, .34, -1e6, and
25.4E-72. As with integers, the sign out front is
completely optional and can be matched by "[+-]?". We can
see that if there is no exponent, floating point numbers
must have a decimal point, otherwise they are integers. We
might be tempted to model these with "\d*\.\d*", but this
would also match just a single decimal point, which is not a
number. So the three cases of floating point number without
exponent are
/[+-]?\d+\./; # 1., 321., etc.
/[+-]?\.\d+/; # .1, .234, etc.
/[+-]?\d+\.\d+/; # 1.0, 30.56, etc.
These can be combined into a single regexp with a three-way
alternation:
/[+-]?(\d+\.\d+|\d+\.|\.\d+)/; # floating point, no exponent
In this alternation, it is important to put '\d+\.\d+'
before '\d+\.'. If '\d+\.' were first, the regexp would
happily match that and ignore the fractional part of the
number.
Now consider floating point numbers with exponents. The key
observation here is that both integers and numbers with
decimal points are allowed in front of an exponent. Then
exponents, like the overall sign, are independent of whether
we are matching numbers with or without decimal points, and
can be 'decoupled' from the mantissa. The overall form of
the regexp now becomes clear:
/^(optional sign)(integer | f.p. mantissa)(optional exponent)$/;
The exponent is an "e" or "E", followed by an integer. So
the exponent regexp is
/[eE][+-]?\d+/; # exponent
Putting all the parts together, we get a regexp that matches
numbers:
/^[+-]?(\d+\.\d+|\d+\.|\.\d+|\d+)([eE][+-]?\d+)?$/; # Ta da!
Long regexps like this may impress your friends, but can be
hard to decipher. In complex situations like this, the
perl v5.12.5 Last change: 2012-11-03 26
Perl Programmers Reference Guide PERLRETUT(1)
"//x" modifier for a match is invaluable. It allows one to
put nearly arbitrary whitespace and comments into a regexp
without affecting their meaning. Using it, we can rewrite
our 'extended' regexp in the more pleasing form
/^
[+-]? # first, match an optional sign
( # then match integers or f.p. mantissas:
\d+\.\d+ # mantissa of the form a.b
|\d+\. # mantissa of the form a.
|\.\d+ # mantissa of the form .b
|\d+ # integer of the form a
)
([eE][+-]?\d+)? # finally, optionally match an exponent
$/x;
If whitespace is mostly irrelevant, how does one include
space characters in an extended regexp? The answer is to
backslash it '\ ' or put it in a character class "[ ]". The
same thing goes for pound signs, use "\#" or "[#]". For
instance, Perl allows a space between the sign and the
mantissa or integer, and we could add this to our regexp as
follows:
/^
[+-]?\ * # first, match an optional sign *and space*
( # then match integers or f.p. mantissas:
\d+\.\d+ # mantissa of the form a.b
|\d+\. # mantissa of the form a.
|\.\d+ # mantissa of the form .b
|\d+ # integer of the form a
)
([eE][+-]?\d+)? # finally, optionally match an exponent
$/x;
In this form, it is easier to see a way to simplify the
alternation. Alternatives 1, 2, and 4 all start with "\d+",
so it could be factored out:
/^
[+-]?\ * # first, match an optional sign
( # then match integers or f.p. mantissas:
\d+ # start out with a ...
(
\.\d* # mantissa of the form a.b or a.
)? # ? takes care of integers of the form a
|\.\d+ # mantissa of the form .b
)
([eE][+-]?\d+)? # finally, optionally match an exponent
$/x;
perl v5.12.5 Last change: 2012-11-03 27
Perl Programmers Reference Guide PERLRETUT(1)
or written in the compact form,
/^[+-]?\ *(\d+(\.\d*)?|\.\d+)([eE][+-]?\d+)?$/;
This is our final regexp. To recap, we built a regexp by
o specifying the task in detail,
o breaking down the problem into smaller parts,
o translating the small parts into regexps,
o combining the regexps,
o and optimizing the final combined regexp.
These are also the typical steps involved in writing a
computer program. This makes perfect sense, because regular
expressions are essentially programs written in a little
computer language that specifies patterns.
Using regular expressions in Perl
The last topic of Part 1 briefly covers how regexps are used
in Perl programs. Where do they fit into Perl syntax?
We have already introduced the matching operator in its
default "/regexp/" and arbitrary delimiter "m!regexp!"
forms. We have used the binding operator "=~" and its
negation "!~" to test for string matches. Associated with
the matching operator, we have discussed the single line
"//s", multi-line "//m", case-insensitive "//i" and extended
"//x" modifiers. There are a few more things you might want
to know about matching operators.
Optimizing pattern evaluation
We pointed out earlier that variables in regexps are
substituted before the regexp is evaluated:
$pattern = 'Seuss';
while (<>) {
print if /$pattern/;
}
This will print any lines containing the word "Seuss". It
is not as efficient as it could be, however, because Perl
has to re-evaluate (or compile) $pattern each time through
the loop. If $pattern won't be changing over the lifetime
of the script, we can add the "//o" modifier, which directs
Perl to only perform variable substitutions once:
perl v5.12.5 Last change: 2012-11-03 28
Perl Programmers Reference Guide PERLRETUT(1)
#!/usr/bin/perl
# Improved simple_grep
$regexp = shift;
while (<>) {
print if /$regexp/o; # a good deal faster
}
Prohibiting substitution
If you change $pattern after the first substitution happens,
Perl will ignore it. If you don't want any substitutions at
all, use the special delimiter "m''":
@pattern = ('Seuss');
while (<>) {
print if m'@pattern'; # matches literal '@pattern', not 'Seuss'
}
Similar to strings, "m''" acts like apostrophes on a regexp;
all other "m" delimiters act like quotes. If the regexp
evaluates to the empty string, the regexp in the last
successful match is used instead. So we have
"dog" =~ /d/; # 'd' matches
"dogbert =~ //; # this matches the 'd' regexp used before
Global matching
The final two modifiers "//g" and "//c" concern multiple
matches. The modifier "//g" stands for global matching and
allows the matching operator to match within a string as
many times as possible. In scalar context, successive
invocations against a string will have `"//g" jump from
match to match, keeping track of position in the string as
it goes along. You can get or set the position with the
"pos()" function.
The use of "//g" is shown in the following example. Suppose
we have a string that consists of words separated by spaces.
If we know how many words there are in advance, we could
extract the words using groupings:
$x = "cat dog house"; # 3 words
$x =~ /^\s*(\w+)\s+(\w+)\s+(\w+)\s*$/; # matches,
# $1 = 'cat'
# $2 = 'dog'
# $3 = 'house'
But what if we had an indeterminate number of words? This is
the sort of task "//g" was made for. To extract all words,
form the simple regexp "(\w+)" and loop over all matches
with "/(\w+)/g":
perl v5.12.5 Last change: 2012-11-03 29
Perl Programmers Reference Guide PERLRETUT(1)
while ($x =~ /(\w+)/g) {
print "Word is $1, ends at position ", pos $x, "\n";
}
prints
Word is cat, ends at position 3
Word is dog, ends at position 7
Word is house, ends at position 13
A failed match or changing the target string resets the
position. If you don't want the position reset after
failure to match, add the "//c", as in "/regexp/gc". The
current position in the string is associated with the
string, not the regexp. This means that different strings
have different positions and their respective positions can
be set or read independently.
In list context, "//g" returns a list of matched groupings,
or if there are no groupings, a list of matches to the whole
regexp. So if we wanted just the words, we could use
@words = ($x =~ /(\w+)/g); # matches,
# $word[0] = 'cat'
# $word[1] = 'dog'
# $word[2] = 'house'
Closely associated with the "//g" modifier is the "\G"
anchor. The "\G" anchor matches at the point where the
previous "//g" match left off. "\G" allows us to easily do
context-sensitive matching:
$metric = 1; # use metric units
...
$x = <FILE>; # read in measurement
$x =~ /^([+-]?\d+)\s*/g; # get magnitude
$weight = $1;
if ($metric) { # error checking
print "Units error!" unless $x =~ /\Gkg\./g;
}
else {
print "Units error!" unless $x =~ /\Glbs\./g;
}
$x =~ /\G\s+(widget|sprocket)/g; # continue processing
The combination of "//g" and "\G" allows us to process the
string a bit at a time and use arbitrary Perl logic to
decide what to do next. Currently, the "\G" anchor is only
fully supported when used to anchor to the start of the
pattern.
perl v5.12.5 Last change: 2012-11-03 30
Perl Programmers Reference Guide PERLRETUT(1)
"\G" is also invaluable in processing fixed length records
with regexps. Suppose we have a snippet of coding region
DNA, encoded as base pair letters "ATCGTTGAAT..." and we
want to find all the stop codons "TGA". In a coding region,
codons are 3-letter sequences, so we can think of the DNA
snippet as a sequence of 3-letter records. The naive regexp
# expanded, this is "ATC GTT GAA TGC AAA TGA CAT GAC"
$dna = "ATCGTTGAATGCAAATGACATGAC";
$dna =~ /TGA/;
doesn't work; it may match a "TGA", but there is no
guarantee that the match is aligned with codon boundaries,
e.g., the substring "GTT GAA" gives a match. A better
solution is
while ($dna =~ /(\w\w\w)*?TGA/g) { # note the minimal *?
print "Got a TGA stop codon at position ", pos $dna, "\n";
}
which prints
Got a TGA stop codon at position 18
Got a TGA stop codon at position 23
Position 18 is good, but position 23 is bogus. What
happened?
The answer is that our regexp works well until we get past
the last real match. Then the regexp will fail to match a
synchronized "TGA" and start stepping ahead one character
position at a time, not what we want. The solution is to
use "\G" to anchor the match to the codon alignment:
while ($dna =~ /\G(\w\w\w)*?TGA/g) {
print "Got a TGA stop codon at position ", pos $dna, "\n";
}
This prints
Got a TGA stop codon at position 18
which is the correct answer. This example illustrates that
it is important not only to match what is desired, but to
reject what is not desired.
Search and replace
Regular expressions also play a big role in search and
replace operations in Perl. Search and replace is
accomplished with the "s///" operator. The general form is
"s/regexp/replacement/modifiers", with everything we know
perl v5.12.5 Last change: 2012-11-03 31
Perl Programmers Reference Guide PERLRETUT(1)
about regexps and modifiers applying in this case as well.
The "replacement" is a Perl double quoted string that
replaces in the string whatever is matched with the
"regexp". The operator "=~" is also used here to associate
a string with "s///". If matching against $_, the "$_ =~"
can be dropped. If there is a match, "s///" returns the
number of substitutions made, otherwise it returns false.
Here are a few examples:
$x = "Time to feed the cat!";
$x =~ s/cat/hacker/; # $x contains "Time to feed the hacker!"
if ($x =~ s/^(Time.*hacker)!$/$1 now!/) {
$more_insistent = 1;
}
$y = "'quoted words'";
$y =~ s/^'(.*)'$/$1/; # strip single quotes,
# $y contains "quoted words"
In the last example, the whole string was matched, but only
the part inside the single quotes was grouped. With the
"s///" operator, the matched variables $1, $2, etc. are
immediately available for use in the replacement expression,
so we use $1 to replace the quoted string with just what was
quoted. With the global modifier, "s///g" will search and
replace all occurrences of the regexp in the string:
$x = "I batted 4 for 4";
$x =~ s/4/four/; # doesn't do it all:
# $x contains "I batted four for 4"
$x = "I batted 4 for 4";
$x =~ s/4/four/g; # does it all:
# $x contains "I batted four for four"
If you prefer 'regex' over 'regexp' in this tutorial, you
could use the following program to replace it:
% cat > simple_replace
#!/usr/bin/perl
$regexp = shift;
$replacement = shift;
while (<>) {
s/$regexp/$replacement/go;
print;
}
^D
% simple_replace regexp regex perlretut.pod
In "simple_replace" we used the "s///g" modifier to replace
all occurrences of the regexp on each line and the "s///o"
modifier to compile the regexp only once. As with
"simple_grep", both the "print" and the
perl v5.12.5 Last change: 2012-11-03 32
Perl Programmers Reference Guide PERLRETUT(1)
"s/$regexp/$replacement/go" use $_ implicitly.
A modifier available specifically to search and replace is
the "s///e" evaluation modifier. "s///e" wraps an
"eval{...}" around the replacement string and the evaluated
result is substituted for the matched substring. "s///e" is
useful if you need to do a bit of computation in the process
of replacing text. This example counts character
frequencies in a line:
$x = "Bill the cat";
$x =~ s/(.)/$chars{$1}++;$1/eg; # final $1 replaces char with itself
print "frequency of '$_' is $chars{$_}\n"
foreach (sort {$chars{$b} <=> $chars{$a}} keys %chars);
This prints
frequency of ' ' is 2
frequency of 't' is 2
frequency of 'l' is 2
frequency of 'B' is 1
frequency of 'c' is 1
frequency of 'e' is 1
frequency of 'h' is 1
frequency of 'i' is 1
frequency of 'a' is 1
As with the match "m//" operator, "s///" can use other
delimiters, such as "s!!!" and "s{}{}", and even "s{}//".
If single quotes are used "s'''", then the regexp and
replacement are treated as single quoted strings and there
are no substitutions. "s///" in list context returns the
same thing as in scalar context, i.e., the number of
matches.
The split function
The "split()" function is another place where a regexp is
used. "split /regexp/, string, limit" separates the
"string" operand into a list of substrings and returns that
list. The regexp must be designed to match whatever
constitutes the separators for the desired substrings. The
"limit", if present, constrains splitting into no more than
"limit" number of strings. For example, to split a string
into words, use
$x = "Calvin and Hobbes";
@words = split /\s+/, $x; # $word[0] = 'Calvin'
# $word[1] = 'and'
# $word[2] = 'Hobbes'
perl v5.12.5 Last change: 2012-11-03 33
Perl Programmers Reference Guide PERLRETUT(1)
If the empty regexp "//" is used, the regexp always matches
and the string is split into individual characters. If the
regexp has groupings, then the resulting list contains the
matched substrings from the groupings as well. For
instance,
$x = "/usr/bin/perl";
@dirs = split m!/!, $x; # $dirs[0] = ''
# $dirs[1] = 'usr'
# $dirs[2] = 'bin'
# $dirs[3] = 'perl'
@parts = split m!(/)!, $x; # $parts[0] = ''
# $parts[1] = '/'
# $parts[2] = 'usr'
# $parts[3] = '/'
# $parts[4] = 'bin'
# $parts[5] = '/'
# $parts[6] = 'perl'
Since the first character of $x matched the regexp, "split"
prepended an empty initial element to the list.
If you have read this far, congratulations! You now have all
the basic tools needed to use regular expressions to solve a
wide range of text processing problems. If this is your
first time through the tutorial, why not stop here and play
around with regexps a while... Part 2 concerns the more
esoteric aspects of regular expressions and those concepts
certainly aren't needed right at the start.
Part 2: Power tools
OK, you know the basics of regexps and you want to know
more. If matching regular expressions is analogous to a
walk in the woods, then the tools discussed in Part 1 are
analogous to topo maps and a compass, basic tools we use all
the time. Most of the tools in part 2 are analogous to
flare guns and satellite phones. They aren't used too often
on a hike, but when we are stuck, they can be invaluable.
What follows are the more advanced, less used, or sometimes
esoteric capabilities of Perl regexps. In Part 2, we will
assume you are comfortable with the basics and concentrate
on the new features.
More on characters, strings, and character classes
There are a number of escape sequences and character classes
that we haven't covered yet.
There are several escape sequences that convert characters
or strings between upper and lower case, and they are also
available within patterns. "\l" and "\u" convert the next
character to lower or upper case, respectively:
perl v5.12.5 Last change: 2012-11-03 34
Perl Programmers Reference Guide PERLRETUT(1)
$x = "perl";
$string =~ /\u$x/; # matches 'Perl' in $string
$x = "M(rs?|s)\\."; # note the double backslash
$string =~ /\l$x/; # matches 'mr.', 'mrs.', and 'ms.',
A "\L" or "\U" indicates a lasting conversion of case, until
terminated by "\E" or thrown over by another "\U" or "\L":
$x = "This word is in lower case:\L SHOUT\E";
$x =~ /shout/; # matches
$x = "I STILL KEYPUNCH CARDS FOR MY 360"
$x =~ /\Ukeypunch/; # matches punch card string
If there is no "\E", case is converted until the end of the
string. The regexps "\L\u$word" or "\u\L$word" convert the
first character of $word to uppercase and the rest of the
characters to lowercase.
Control characters can be escaped with "\c", so that a
control-Z character would be matched with "\cZ". The escape
sequence "\Q"..."\E" quotes, or protects most non-alphabetic
characters. For instance,
$x = "\QThat !^*&%~& cat!";
$x =~ /\Q!^*&%~&\E/; # check for rough language
It does not protect "$" or "@", so that variables can still
be substituted.
With the advent of 5.6.0, Perl regexps can handle more than
just the standard ASCII character set. Perl now supports
Unicode, a standard for representing the alphabets from
virtually all of the world's written languages, and a host
of symbols. Perl's text strings are Unicode strings, so
they can contain characters with a value (codepoint or
character number) higher than 255
What does this mean for regexps? Well, regexp users don't
need to know much about Perl's internal representation of
strings. But they do need to know 1) how to represent
Unicode characters in a regexp and 2) that a matching
operation will treat the string to be searched as a sequence
of characters, not bytes. The answer to 1) is that Unicode
characters greater than "chr(255)" are represented using the
"\x{hex}" notation, because the \0 octal and \x hex (without
curly braces) don't go further than 255.
/\x{263a}/; # match a Unicode smiley face :)
NOTE: In Perl 5.6.0 it used to be that one needed to say
"use utf8" to use any Unicode features. This is no more the
case: for almost all Unicode processing, the explicit "utf8"
perl v5.12.5 Last change: 2012-11-03 35
Perl Programmers Reference Guide PERLRETUT(1)
pragma is not needed. (The only case where it matters is if
your Perl script is in Unicode and encoded in UTF-8, then an
explicit "use utf8" is needed.)
Figuring out the hexadecimal sequence of a Unicode character
you want or deciphering someone else's hexadecimal Unicode
regexp is about as much fun as programming in machine code.
So another way to specify Unicode characters is to use the
named character escape sequence "\N{name}". name is a name
for the Unicode character, as specified in the Unicode
standard. For instance, if we wanted to represent or match
the astrological sign for the planet Mercury, we could use
use charnames ":full"; # use named chars with Unicode full names
$x = "abc\N{MERCURY}def";
$x =~ /\N{MERCURY}/; # matches
One can also use short names or restrict names to a certain
alphabet:
use charnames ':full';
print "\N{GREEK SMALL LETTER SIGMA} is called sigma.\n";
use charnames ":short";
print "\N{greek:Sigma} is an upper-case sigma.\n";
use charnames qw(greek);
print "\N{sigma} is Greek sigma\n";
A list of full names is found in the file NamesList.txt in
the lib/perl5/X.X.X/unicore directory (where X.X.X is the
perl version number as it is installed on your system).
The answer to requirement 2), as of 5.6.0, is that a regexp
uses Unicode characters. Internally, this is encoded to
bytes using either UTF-8 or a native 8 bit encoding,
depending on the history of the string, but conceptually it
is a sequence of characters, not bytes. See perlunitut for a
tutorial about that.
Let us now discuss Unicode character classes. Just as with
Unicode characters, there are named Unicode character
classes represented by the "\p{name}" escape sequence.
Closely associated is the "\P{name}" character class, which
is the negation of the "\p{name}" class. For example, to
match lower and uppercase characters,
perl v5.12.5 Last change: 2012-11-03 36
Perl Programmers Reference Guide PERLRETUT(1)
use charnames ":full"; # use named chars with Unicode full names
$x = "BOB";
$x =~ /^\p{IsUpper}/; # matches, uppercase char class
$x =~ /^\P{IsUpper}/; # doesn't match, char class sans uppercase
$x =~ /^\p{IsLower}/; # doesn't match, lowercase char class
$x =~ /^\P{IsLower}/; # matches, char class sans lowercase
Here is the association between some Perl named classes and
the traditional Unicode classes:
Perl class name Unicode class name or regular expression
IsAlpha /^[LM]/
IsAlnum /^[LMN]/
IsASCII $code <= 127
IsCntrl /^C/
IsBlank $code =~ /^(0020|0009)$/ || /^Z[^lp]/
IsDigit Nd
IsGraph /^([LMNPS]|Co)/
IsLower Ll
IsPrint /^([LMNPS]|Co|Zs)/
IsPunct /^P/
IsSpace /^Z/ || ($code =~ /^(0009|000A|000B|000C|000D)$/
IsSpacePerl /^Z/ || ($code =~ /^(0009|000A|000C|000D|0085|2028|2029)$/
IsUpper /^L[ut]/
IsWord /^[LMN]/ || $code eq "005F"
IsXDigit $code =~ /^00(3[0-9]|[46][1-6])$/
You can also use the official Unicode class names with the
"\p" and "\P", like "\p{L}" for Unicode 'letters', or
"\p{Lu}" for uppercase letters, or "\P{Nd}" for non-digits.
If a "name" is just one letter, the braces can be dropped.
For instance, "\pM" is the character class of Unicode
'marks', for example accent marks. For the full list see
perlunicode.
The Unicode has also been separated into various sets of
characters which you can test with "\p{...}" (in) and
"\P{...}" (not in). To test whether a character is (or is
not) an element of a script you would use the script name,
for example "\p{Latin}", "\p{Greek}", or "\P{Katakana}".
Other sets are the Unicode blocks, the names of which begin
with "In". One such block is dedicated to mathematical
operators, and its pattern formula is
<C\p{InMathematicalOperators>}>. For the full list see
perluniprops.
What we have described so far is the single form of the
"\p{...}" character classes. There is also a compound form
which you may run into. These look like "\p{name=value}" or
"\p{name:value}" (the equals sign and colon can be used
interchangeably). These are more general than the single
perl v5.12.5 Last change: 2012-11-03 37
Perl Programmers Reference Guide PERLRETUT(1)
form, and in fact most of the single forms are just Perl-
defined shortcuts for common compound forms. For example,
the script examples in the previous paragraph could be
written equivalently as "\p{Script=Latin}",
"\p{Script:Greek}", and "\P{script=katakana}" (case is
irrelevant between the "{}" braces). You may never have to
use the compound forms, but sometimes it is necessary, and
their use can make your code easier to understand.
"\X" is an abbreviation for a character class that comprises
a Unicode extended grapheme cluster. This represents a
"logical character", what appears to be a single character,
but may be represented internally by more than one. As an
example, using the Unicode full names, e.g.,
"A + COMBINING RING" is a grapheme cluster with base
character "A" and combining character "COMBINING RING",
which translates in Danish to A with the circle atop it, as
in the word Angstrom.
For the full and latest information about Unicode see the
latest Unicode standard, or the Unicode Consortium's website
<http://www.unicode.org>
As if all those classes weren't enough, Perl also defines
POSIX style character classes. These have the form
"[:name:]", with "name" the name of the POSIX class. The
POSIX classes are "alpha", "alnum", "ascii", "cntrl",
"digit", "graph", "lower", "print", "punct", "space",
"upper", and "xdigit", and two extensions, "word" (a Perl
extension to match "\w"), and "blank" (a GNU extension). If
"utf8" is being used, then these classes are defined the
same as their corresponding Perl Unicode classes:
"[:upper:]" is the same as "\p{IsUpper}", etc. The POSIX
character classes, however, don't require using "utf8". The
"[:digit:]", "[:word:]", and "[:space:]" correspond to the
familiar "\d", "\w", and "\s" character classes. To negate
a POSIX class, put a "^" in front of the name, so that,
e.g., "[:^digit:]" corresponds to "\D" and under "utf8",
"\P{IsDigit}". The Unicode and POSIX character classes can
be used just like "\d", with the exception that POSIX
character classes can only be used inside of a character
class:
/\s+[abc[:digit:]xyz]\s*/; # match a,b,c,x,y,z, or a digit
/^=item\s[[:digit:]]/; # match '=item',
# followed by a space and a digit
use charnames ":full";
/\s+[abc\p{IsDigit}xyz]\s+/; # match a,b,c,x,y,z, or a digit
/^=item\s\p{IsDigit}/; # match '=item',
# followed by a space and a digit
perl v5.12.5 Last change: 2012-11-03 38
Perl Programmers Reference Guide PERLRETUT(1)
Whew! That is all the rest of the characters and character
classes.
Compiling and saving regular expressions
In Part 1 we discussed the "//o" modifier, which compiles a
regexp just once. This suggests that a compiled regexp is
some data structure that can be stored once and used again
and again. The regexp quote "qr//" does exactly that:
"qr/string/" compiles the "string" as a regexp and
transforms the result into a form that can be assigned to a
variable:
$reg = qr/foo+bar?/; # reg contains a compiled regexp
Then $reg can be used as a regexp:
$x = "fooooba";
$x =~ $reg; # matches, just like /foo+bar?/
$x =~ /$reg/; # same thing, alternate form
$reg can also be interpolated into a larger regexp:
$x =~ /(abc)?$reg/; # still matches
As with the matching operator, the regexp quote can use
different delimiters, e.g., "qr!!", "qr{}" or "qr~~".
Apostrophes as delimiters ("qr''") inhibit any
interpolation.
Pre-compiled regexps are useful for creating dynamic matches
that don't need to be recompiled each time they are
encountered. Using pre-compiled regexps, we write a
"grep_step" program which greps for a sequence of patterns,
advancing to the next pattern as soon as one has been
satisfied.
% cat > grep_step
#!/usr/bin/perl
# grep_step - match <number> regexps, one after the other
# usage: multi_grep <number> regexp1 regexp2 ... file1 file2 ...
$number = shift;
$regexp[$_] = shift foreach (0..$number-1);
@compiled = map qr/$_/, @regexp;
while ($line = <>) {
if ($line =~ /$compiled[0]/) {
print $line;
shift @compiled;
last unless @compiled;
}
}
^D
perl v5.12.5 Last change: 2012-11-03 39
Perl Programmers Reference Guide PERLRETUT(1)
% grep_step 3 shift print last grep_step
$number = shift;
print $line;
last unless @compiled;
Storing pre-compiled regexps in an array @compiled allows us
to simply loop through the regexps without any
recompilation, thus gaining flexibility without sacrificing
speed.
Composing regular expressions at runtime
Backtracking is more efficient than repeated tries with
different regular expressions. If there are several regular
expressions and a match with any of them is acceptable, then
it is possible to combine them into a set of alternatives.
If the individual expressions are input data, this can be
done by programming a join operation. We'll exploit this
idea in an improved version of the "simple_grep" program: a
program that matches multiple patterns:
% cat > multi_grep
#!/usr/bin/perl
# multi_grep - match any of <number> regexps
# usage: multi_grep <number> regexp1 regexp2 ... file1 file2 ...
$number = shift;
$regexp[$_] = shift foreach (0..$number-1);
$pattern = join '|', @regexp;
while ($line = <>) {
print $line if $line =~ /$pattern/o;
}
^D
% multi_grep 2 shift for multi_grep
$number = shift;
$regexp[$_] = shift foreach (0..$number-1);
Sometimes it is advantageous to construct a pattern from the
input that is to be analyzed and use the permissible values
on the left hand side of the matching operations. As an
example for this somewhat paradoxical situation, let's
assume that our input contains a command verb which should
match one out of a set of available command verbs, with the
additional twist that commands may be abbreviated as long as
the given string is unique. The program below demonstrates
the basic algorithm.
perl v5.12.5 Last change: 2012-11-03 40
Perl Programmers Reference Guide PERLRETUT(1)
% cat > keymatch
#!/usr/bin/perl
$kwds = 'copy compare list print';
while( $command = <> ){
$command =~ s/^\s+|\s+$//g; # trim leading and trailing spaces
if( ( @matches = $kwds =~ /\b$command\w*/g ) == 1 ){
print "command: '@matches'\n";
} elsif( @matches == 0 ){
print "no such command: '$command'\n";
} else {
print "not unique: '$command' (could be one of: @matches)\n";
}
}
^D
% keymatch
li
command: 'list'
co
not unique: 'co' (could be one of: copy compare)
printer
no such command: 'printer'
Rather than trying to match the input against the keywords,
we match the combined set of keywords against the input.
The pattern matching operation "$kwds =~ /\b($command\w*)/g"
does several things at the same time. It makes sure that the
given command begins where a keyword begins ("\b"). It
tolerates abbreviations due to the added "\w*". It tells us
the number of matches ("scalar @matches") and all the
keywords that were actually matched. You could hardly ask
for more.
Embedding comments and modifiers in a regular expression
Starting with this section, we will be discussing Perl's set
of extended patterns. These are extensions to the
traditional regular expression syntax that provide powerful
new tools for pattern matching. We have already seen
extensions in the form of the minimal matching constructs
"??", "*?", "+?", "{n,m}?", and "{n,}?". The rest of the
extensions below have the form "(?char...)", where the
"char" is a character that determines the type of extension.
The first extension is an embedded comment "(?#text)". This
embeds a comment into the regular expression without
affecting its meaning. The comment should not have any
closing parentheses in the text. An example is
/(?# Match an integer:)[+-]?\d+/;
This style of commenting has been largely superseded by the
raw, freeform commenting that is allowed with the "//x"
perl v5.12.5 Last change: 2012-11-03 41
Perl Programmers Reference Guide PERLRETUT(1)
modifier.
The modifiers "//i", "//m", "//s" and "//x" (or any
combination thereof) can also be embedded in a regexp using
"(?i)", "(?m)", "(?s)", and "(?x)". For instance,
/(?i)yes/; # match 'yes' case insensitively
/yes/i; # same thing
/(?x)( # freeform version of an integer regexp
[+-]? # match an optional sign
\d+ # match a sequence of digits
)
/x;
Embedded modifiers can have two important advantages over
the usual modifiers. Embedded modifiers allow a custom set
of modifiers to each regexp pattern. This is great for
matching an array of regexps that must have different
modifiers:
$pattern[0] = '(?i)doctor';
$pattern[1] = 'Johnson';
...
while (<>) {
foreach $patt (@pattern) {
print if /$patt/;
}
}
The second advantage is that embedded modifiers (except
"//p", which modifies the entire regexp) only affect the
regexp inside the group the embedded modifier is contained
in. So grouping can be used to localize the modifier's
effects:
/Answer: ((?i)yes)/; # matches 'Answer: yes', 'Answer: YES', etc.
Embedded modifiers can also turn off any modifiers already
present by using, e.g., "(?-i)". Modifiers can also be
combined into a single expression, e.g., "(?s-i)" turns on
single line mode and turns off case insensitivity.
Embedded modifiers may also be added to a non-capturing
grouping. "(?i-m:regexp)" is a non-capturing grouping that
matches "regexp" case insensitively and turns off multi-line
mode.
Looking ahead and looking behind
This section concerns the lookahead and lookbehind
assertions. First, a little background.
perl v5.12.5 Last change: 2012-11-03 42
Perl Programmers Reference Guide PERLRETUT(1)
In Perl regular expressions, most regexp elements 'eat up' a
certain amount of string when they match. For instance, the
regexp element "[abc}]" eats up one character of the string
when it matches, in the sense that Perl moves to the next
character position in the string after the match. There are
some elements, however, that don't eat up characters
(advance the character position) if they match. The
examples we have seen so far are the anchors. The anchor
"^" matches the beginning of the line, but doesn't eat any
characters. Similarly, the word boundary anchor "\b"
matches wherever a character matching "\w" is next to a
character that doesn't, but it doesn't eat up any characters
itself. Anchors are examples of zero-width assertions.
Zero-width, because they consume no characters, and
assertions, because they test some property of the string.
In the context of our walk in the woods analogy to regexp
matching, most regexp elements move us along a trail, but
anchors have us stop a moment and check our surroundings.
If the local environment checks out, we can proceed forward.
But if the local environment doesn't satisfy us, we must
backtrack.
Checking the environment entails either looking ahead on the
trail, looking behind, or both. "^" looks behind, to see
that there are no characters before. "$" looks ahead, to
see that there are no characters after. "\b" looks both
ahead and behind, to see if the characters on either side
differ in their "word-ness".
The lookahead and lookbehind assertions are generalizations
of the anchor concept. Lookahead and lookbehind are zero-
width assertions that let us specify which characters we
want to test for. The lookahead assertion is denoted by
"(?=regexp)" and the lookbehind assertion is denoted by
"(?<=fixed-regexp)". Some examples are
$x = "I catch the housecat 'Tom-cat' with catnip";
$x =~ /cat(?=\s)/; # matches 'cat' in 'housecat'
@catwords = ($x =~ /(?<=\s)cat\w+/g); # matches,
# $catwords[0] = 'catch'
# $catwords[1] = 'catnip'
$x =~ /\bcat\b/; # matches 'cat' in 'Tom-cat'
$x =~ /(?<=\s)cat(?=\s)/; # doesn't match; no isolated 'cat' in
# middle of $x
Note that the parentheses in "(?=regexp)" and "(?<=regexp)"
are non-capturing, since these are zero-width assertions.
Thus in the second regexp, the substrings captured are those
of the whole regexp itself. Lookahead "(?=regexp)" can
match arbitrary regexps, but lookbehind "(?<=fixed-regexp)"
only works for regexps of fixed width, i.e., a fixed number
of characters long. Thus "(?<=(ab|bc))" is fine, but
perl v5.12.5 Last change: 2012-11-03 43
Perl Programmers Reference Guide PERLRETUT(1)
"(?<=(ab)*)" is not. The negated versions of the lookahead
and lookbehind assertions are denoted by "(?!regexp)" and
"(?<!fixed-regexp)" respectively. They evaluate true if the
regexps do not match:
$x = "foobar";
$x =~ /foo(?!bar)/; # doesn't match, 'bar' follows 'foo'
$x =~ /foo(?!baz)/; # matches, 'baz' doesn't follow 'foo'
$x =~ /(?<!\s)foo/; # matches, there is no \s before 'foo'
The "\C" is unsupported in lookbehind, because the already
treacherous definition of "\C" would become even more so
when going backwards.
Here is an example where a string containing blank-separated
words, numbers and single dashes is to be split into its
components. Using "/\s+/" alone won't work, because spaces
are not required between dashes, or a word or a dash.
Additional places for a split are established by looking
ahead and behind:
$str = "one two - --6-8";
@toks = split / \s+ # a run of spaces
| (?<=\S) (?=-) # any non-space followed by '-'
| (?<=-) (?=\S) # a '-' followed by any non-space
/x, $str; # @toks = qw(one two - - - 6 - 8)
Using independent subexpressions to prevent backtracking
Independent subexpressions are regular expressions, in the
context of a larger regular expression, that function
independently of the larger regular expression. That is,
they consume as much or as little of the string as they wish
without regard for the ability of the larger regexp to
match. Independent subexpressions are represented by
"(?>regexp)". We can illustrate their behavior by first
considering an ordinary regexp:
$x = "ab";
$x =~ /a*ab/; # matches
This obviously matches, but in the process of matching, the
subexpression "a*" first grabbed the "a". Doing so,
however, wouldn't allow the whole regexp to match, so after
backtracking, "a*" eventually gave back the "a" and matched
the empty string. Here, what "a*" matched was dependent on
what the rest of the regexp matched.
Contrast that with an independent subexpression:
$x =~ /(?>a*)ab/; # doesn't match!
perl v5.12.5 Last change: 2012-11-03 44
Perl Programmers Reference Guide PERLRETUT(1)
The independent subexpression "(?>a*)" doesn't care about
the rest of the regexp, so it sees an "a" and grabs it.
Then the rest of the regexp "ab" cannot match. Because
"(?>a*)" is independent, there is no backtracking and the
independent subexpression does not give up its "a". Thus
the match of the regexp as a whole fails. A similar
behavior occurs with completely independent regexps:
$x = "ab";
$x =~ /a*/g; # matches, eats an 'a'
$x =~ /\Gab/g; # doesn't match, no 'a' available
Here "//g" and "\G" create a 'tag team' handoff of the
string from one regexp to the other. Regexps with an
independent subexpression are much like this, with a handoff
of the string to the independent subexpression, and a
handoff of the string back to the enclosing regexp.
The ability of an independent subexpression to prevent
backtracking can be quite useful. Suppose we want to match
a non-empty string enclosed in parentheses up to two levels
deep. Then the following regexp matches:
$x = "abc(de(fg)h"; # unbalanced parentheses
$x =~ /\( ( [^()]+ | \([^()]*\) )+ \)/x;
The regexp matches an open parenthesis, one or more copies
of an alternation, and a close parenthesis. The alternation
is two-way, with the first alternative "[^()]+" matching a
substring with no parentheses and the second alternative
"\([^()]*\)" matching a substring delimited by parentheses.
The problem with this regexp is that it is pathological: it
has nested indeterminate quantifiers of the form "(a+|b)+".
We discussed in Part 1 how nested quantifiers like this
could take an exponentially long time to execute if there
was no match possible. To prevent the exponential blowup,
we need to prevent useless backtracking at some point. This
can be done by enclosing the inner quantifier as an
independent subexpression:
$x =~ /\( ( (?>[^()]+) | \([^()]*\) )+ \)/x;
Here, "(?>[^()]+)" breaks the degeneracy of string
partitioning by gobbling up as much of the string as
possible and keeping it. Then match failures fail much
more quickly.
Conditional expressions
A conditional expression is a form of if-then-else statement
that allows one to choose which patterns are to be matched,
based on some condition. There are two types of conditional
expression: "(?(condition)yes-regexp)" and
perl v5.12.5 Last change: 2012-11-03 45
Perl Programmers Reference Guide PERLRETUT(1)
"(?(condition)yes-regexp|no-regexp)".
"(?(condition)yes-regexp)" is like an 'if () {}' statement
in Perl. If the "condition" is true, the "yes-regexp" will
be matched. If the "condition" is false, the "yes-regexp"
will be skipped and Perl will move onto the next regexp
element. The second form is like an 'if () {} else {}'
statement in Perl. If the "condition" is true, the
"yes-regexp" will be matched, otherwise the "no-regexp" will
be matched.
The "condition" can have several forms. The first form is
simply an integer in parentheses "(integer)". It is true if
the corresponding backreference "\integer" matched earlier
in the regexp. The same thing can be done with a name
associated with a capture buffer, written as "(<name>)" or
"('name')". The second form is a bare zero width assertion
"(?...)", either a lookahead, a lookbehind, or a code
assertion (discussed in the next section). The third set of
forms provides tests that return true if the expression is
executed within a recursion ("(R)") or is being called from
some capturing group, referenced either by number ("(R1)",
"(R2)",...) or by name ("(R&name)").
The integer or name form of the "condition" allows us to
choose, with more flexibility, what to match based on what
matched earlier in the regexp. This searches for words of
the form "$x$x" or "$x$y$y$x":
% simple_grep '^(\w+)(\w+)?(?(2)\2\1|\1)$' /usr/dict/words
beriberi
coco
couscous
deed
...
toot
toto
tutu
The lookbehind "condition" allows, along with
backreferences, an earlier part of the match to influence a
later part of the match. For instance,
/[ATGC]+(?(?<=AA)G|C)$/;
matches a DNA sequence such that it either ends in "AAG", or
some other base pair combination and "C". Note that the
form is "(?(?<=AA)G|C)" and not "(?((?<=AA))G|C)"; for the
lookahead, lookbehind or code assertions, the parentheses
around the conditional are not needed.
Defining named patterns
Some regular expressions use identical subpatterns in
perl v5.12.5 Last change: 2012-11-03 46
Perl Programmers Reference Guide PERLRETUT(1)
several places. Starting with Perl 5.10, it is possible to
define named subpatterns in a section of the pattern so that
they can be called up by name anywhere in the pattern. This
syntactic pattern for this definition group is
"(?(DEFINE)(?<name>pattern)...)". An insertion of a named
pattern is written as "(?&name)".
The example below illustrates this feature using the pattern
for floating point numbers that was presented earlier on.
The three subpatterns that are used more than once are the
optional sign, the digit sequence for an integer and the
decimal fraction. The DEFINE group at the end of the
pattern contains their definition. Notice that the decimal
fraction pattern is the first place where we can reuse the
integer pattern.
/^ (?&osg)\ * ( (?&int)(?&dec)? | (?&dec) )
(?: [eE](?&osg)(?&int) )?
$
(?(DEFINE)
(?<osg>[-+]?) # optional sign
(?<int>\d++) # integer
(?<dec>\.(?&int)) # decimal fraction
)/x
Recursive patterns
This feature (introduced in Perl 5.10) significantly extends
the power of Perl's pattern matching. By referring to some
other capture group anywhere in the pattern with the
construct "(?group-ref)", the pattern within the referenced
group is used as an independent subpattern in place of the
group reference itself. Because the group reference may be
contained within the group it refers to, it is now possible
to apply pattern matching to tasks that hitherto required a
recursive parser.
To illustrate this feature, we'll design a pattern that
matches if a string contains a palindrome. (This is a word
or a sentence that, while ignoring spaces, interpunctuation
and case, reads the same backwards as forwards. We begin by
observing that the empty string or a string containing just
one word character is a palindrome. Otherwise it must have a
word character up front and the same at its end, with
another palindrome in between.
/(?: (\w) (?...Here be a palindrome...) \g{-1} | \w? )/x
Adding "\W*" at either end to eliminate what is to be
ignored, we already have the full pattern:
perl v5.12.5 Last change: 2012-11-03 47
Perl Programmers Reference Guide PERLRETUT(1)
my $pp = qr/^(\W* (?: (\w) (?1) \g{-1} | \w? ) \W*)$/ix;
for $s ( "saippuakauppias", "A man, a plan, a canal: Panama!" ){
print "'$s' is a palindrome\n" if $s =~ /$pp/;
}
In "(?...)" both absolute and relative backreferences may be
used. The entire pattern can be reinserted with "(?R)" or
"(?0)". If you prefer to name your buffers, you can use
"(?&name)" to recurse into that buffer.
A bit of magic: executing Perl code in a regular expression
Normally, regexps are a part of Perl expressions. Code
evaluation expressions turn that around by allowing
arbitrary Perl code to be a part of a regexp. A code
evaluation expression is denoted "(?{code})", with code a
string of Perl statements.
Be warned that this feature is considered experimental, and
may be changed without notice.
Code expressions are zero-width assertions, and the value
they return depends on their environment. There are two
possibilities: either the code expression is used as a
conditional in a conditional expression "(?(condition)...)",
or it is not. If the code expression is a conditional, the
code is evaluated and the result (i.e., the result of the
last statement) is used to determine truth or falsehood. If
the code expression is not used as a conditional, the
assertion always evaluates true and the result is put into
the special variable $^R. The variable $^R can then be used
in code expressions later in the regexp. Here are some
silly examples:
$x = "abcdef";
$x =~ /abc(?{print "Hi Mom!";})def/; # matches,
# prints 'Hi Mom!'
$x =~ /aaa(?{print "Hi Mom!";})def/; # doesn't match,
# no 'Hi Mom!'
Pay careful attention to the next example:
$x =~ /abc(?{print "Hi Mom!";})ddd/; # doesn't match,
# no 'Hi Mom!'
# but why not?
At first glance, you'd think that it shouldn't print,
because obviously the "ddd" isn't going to match the target
string. But look at this example:
$x =~ /abc(?{print "Hi Mom!";})[dD]dd/; # doesn't match,
# but _does_ print
perl v5.12.5 Last change: 2012-11-03 48
Perl Programmers Reference Guide PERLRETUT(1)
Hmm. What happened here? If you've been following along, you
know that the above pattern should be effectively (almost)
the same as the last one; enclosing the "d" in a character
class isn't going to change what it matches. So why does the
first not print while the second one does?
The answer lies in the optimizations the regex engine makes.
In the first case, all the engine sees are plain old
characters (aside from the "?{}" construct). It's smart
enough to realize that the string 'ddd' doesn't occur in our
target string before actually running the pattern through.
But in the second case, we've tricked it into thinking that
our pattern is more complicated. It takes a look, sees our
character class, and decides that it will have to actually
run the pattern to determine whether or not it matches, and
in the process of running it hits the print statement before
it discovers that we don't have a match.
To take a closer look at how the engine does optimizations,
see the section "Pragmas and debugging" below.
More fun with "?{}":
$x =~ /(?{print "Hi Mom!";})/; # matches,
# prints 'Hi Mom!'
$x =~ /(?{$c = 1;})(?{print "$c";})/; # matches,
# prints '1'
$x =~ /(?{$c = 1;})(?{print "$^R";})/; # matches,
# prints '1'
The bit of magic mentioned in the section title occurs when
the regexp backtracks in the process of searching for a
match. If the regexp backtracks over a code expression and
if the variables used within are localized using "local",
the changes in the variables produced by the code expression
are undone! Thus, if we wanted to count how many times a
character got matched inside a group, we could use, e.g.,
$x = "aaaa";
$count = 0; # initialize 'a' count
$c = "bob"; # test if $c gets clobbered
$x =~ /(?{local $c = 0;}) # initialize count
( a # match 'a'
(?{local $c = $c + 1;}) # increment count
)* # do this any number of times,
aa # but match 'aa' at the end
(?{$count = $c;}) # copy local $c var into $count
/x;
print "'a' count is $count, \$c variable is '$c'\n";
This prints
perl v5.12.5 Last change: 2012-11-03 49
Perl Programmers Reference Guide PERLRETUT(1)
'a' count is 2, $c variable is 'bob'
If we replace the " (?{local $c = $c + 1;})" with
" (?{$c = $c + 1;})", the variable changes are not undone
during backtracking, and we get
'a' count is 4, $c variable is 'bob'
Note that only localized variable changes are undone. Other
side effects of code expression execution are permanent.
Thus
$x = "aaaa";
$x =~ /(a(?{print "Yow\n";}))*aa/;
produces
Yow
Yow
Yow
Yow
The result $^R is automatically localized, so that it will
behave properly in the presence of backtracking.
This example uses a code expression in a conditional to
match a definite article, either 'the' in English or
'der|die|das' in German:
$lang = 'DE'; # use German
...
$text = "das";
print "matched\n"
if $text =~ /(?(?{
$lang eq 'EN'; # is the language English?
})
the | # if so, then match 'the'
(der|die|das) # else, match 'der|die|das'
)
/xi;
Note that the syntax here is
"(?(?{...})yes-regexp|no-regexp)", not
"(?((?{...}))yes-regexp|no-regexp)". In other words, in the
case of a code expression, we don't need the extra
parentheses around the conditional.
If you try to use code expressions with interpolating
variables, Perl may surprise you:
perl v5.12.5 Last change: 2012-11-03 50
Perl Programmers Reference Guide PERLRETUT(1)
$bar = 5;
$pat = '(?{ 1 })';
/foo(?{ $bar })bar/; # compiles ok, $bar not interpolated
/foo(?{ 1 })$bar/; # compile error!
/foo${pat}bar/; # compile error!
$pat = qr/(?{ $foo = 1 })/; # precompile code regexp
/foo${pat}bar/; # compiles ok
If a regexp has (1) code expressions and interpolating
variables, or (2) a variable that interpolates a code
expression, Perl treats the regexp as an error. If the code
expression is precompiled into a variable, however,
interpolating is ok. The question is, why is this an error?
The reason is that variable interpolation and code
expressions together pose a security risk. The combination
is dangerous because many programmers who write search
engines often take user input and plug it directly into a
regexp:
$regexp = <>; # read user-supplied regexp
$chomp $regexp; # get rid of possible newline
$text =~ /$regexp/; # search $text for the $regexp
If the $regexp variable contains a code expression, the user
could then execute arbitrary Perl code. For instance, some
joker could search for "system('rm -rf *');" to erase your
files. In this sense, the combination of interpolation and
code expressions taints your regexp. So by default, using
both interpolation and code expressions in the same regexp
is not allowed. If you're not concerned about malicious
users, it is possible to bypass this security check by
invoking "use re 'eval'":
use re 'eval'; # throw caution out the door
$bar = 5;
$pat = '(?{ 1 })';
/foo(?{ 1 })$bar/; # compiles ok
/foo${pat}bar/; # compiles ok
Another form of code expression is the pattern code
expression. The pattern code expression is like a regular
code expression, except that the result of the code
evaluation is treated as a regular expression and matched
immediately. A simple example is
$length = 5;
$char = 'a';
$x = 'aaaaabb';
$x =~ /(??{$char x $length})/x; # matches, there are 5 of 'a'
perl v5.12.5 Last change: 2012-11-03 51
Perl Programmers Reference Guide PERLRETUT(1)
This final example contains both ordinary and pattern code
expressions. It detects whether a binary string
1101010010001... has a Fibonacci spacing 0,1,1,2,3,5,... of
the 1's:
$x = "1101010010001000001";
$z0 = ''; $z1 = '0'; # initial conditions
print "It is a Fibonacci sequence\n"
if $x =~ /^1 # match an initial '1'
(?:
((??{ $z0 })) # match some '0'
1 # and then a '1'
(?{ $z0 = $z1; $z1 .= $^N; })
)+ # repeat as needed
$ # that is all there is
/x;
printf "Largest sequence matched was %d\n", length($z1)-length($z0);
Remember that $^N is set to whatever was matched by the last
completed capture group. This prints
It is a Fibonacci sequence
Largest sequence matched was 5
Ha! Try that with your garden variety regexp package...
Note that the variables $z0 and $z1 are not substituted when
the regexp is compiled, as happens for ordinary variables
outside a code expression. Rather, the code expressions are
evaluated when Perl encounters them during the search for a
match.
The regexp without the "//x" modifier is
/^1(?:((??{ $z0 }))1(?{ $z0 = $z1; $z1 .= $^N; }))+$/
which shows that spaces are still possible in the code
parts. Nevertheless, when working with code and conditional
expressions, the extended form of regexps is almost
necessary in creating and debugging regexps.
Backtracking control verbs
Perl 5.10 introduced a number of control verbs intended to
provide detailed control over the backtracking process, by
directly influencing the regexp engine and by providing
monitoring techniques. As all the features in this group
are experimental and subject to change or removal in a
future version of Perl, the interested reader is referred to
"Special Backtracking Control Verbs" in perlre for a
detailed description.
perl v5.12.5 Last change: 2012-11-03 52
Perl Programmers Reference Guide PERLRETUT(1)
Below is just one example, illustrating the control verb
"(*FAIL)", which may be abbreviated as "(*F)". If this is
inserted in a regexp it will cause to fail, just like at
some mismatch between the pattern and the string. Processing
of the regexp continues like after any "normal" failure, so
that, for instance, the next position in the string or
another alternative will be tried. As failing to match
doesn't preserve capture buffers or produce results, it may
be necessary to use this in combination with embedded code.
%count = ();
"supercalifragilisticexpialidoceous" =~
/([aeiou])(?{ $count{$1}++; })(*FAIL)/oi;
printf "%3d '%s'\n", $count{$_}, $_ for (sort keys %count);
The pattern begins with a class matching a subset of
letters. Whenever this matches, a statement like
"$count{'a'}++;" is executed, incrementing the letter's
counter. Then "(*FAIL)" does what it says, and the regexp
engine proceeds according to the book: as long as the end of
the string hasn't been reached, the position is advanced
before looking for another vowel. Thus, match or no match
makes no difference, and the regexp engine proceeds until
the entire string has been inspected. (It's remarkable that
an alternative solution using something like
$count{lc($_)}++ for split('', "supercalifragilisticexpialidoceous");
printf "%3d '%s'\n", $count2{$_}, $_ for ( qw{ a e i o u } );
is considerably slower.)
Pragmas and debugging
Speaking of debugging, there are several pragmas available
to control and debug regexps in Perl. We have already
encountered one pragma in the previous section,
"use re 'eval';", that allows variable interpolation and
code expressions to coexist in a regexp. The other pragmas
are
use re 'taint';
$tainted = <>;
@parts = ($tainted =~ /(\w+)\s+(\w+)/; # @parts is now tainted
The "taint" pragma causes any substrings from a match with a
tainted variable to be tainted as well. This is not
normally the case, as regexps are often used to extract the
safe bits from a tainted variable. Use "taint" when you are
not extracting safe bits, but are performing some other
processing. Both "taint" and "eval" pragmas are lexically
scoped, which means they are in effect only until the end of
the block enclosing the pragmas.
perl v5.12.5 Last change: 2012-11-03 53
Perl Programmers Reference Guide PERLRETUT(1)
use re 'debug';
/^(.*)$/s; # output debugging info
use re 'debugcolor';
/^(.*)$/s; # output debugging info in living color
The global "debug" and "debugcolor" pragmas allow one to get
detailed debugging info about regexp compilation and
execution. "debugcolor" is the same as debug, except the
debugging information is displayed in color on terminals
that can display termcap color sequences. Here is example
output:
% perl -e 'use re "debug"; "abc" =~ /a*b+c/;'
Compiling REx `a*b+c'
size 9 first at 1
1: STAR(4)
2: EXACT <a>(0)
4: PLUS(7)
5: EXACT <b>(0)
7: EXACT <c>(9)
9: END(0)
floating `bc' at 0..2147483647 (checking floating) minlen 2
Guessing start of match, REx `a*b+c' against `abc'...
Found floating substr `bc' at offset 1...
Guessed: match at offset 0
Matching REx `a*b+c' against `abc'
Setting an EVAL scope, savestack=3
0 <> <abc> | 1: STAR
EXACT <a> can match 1 times out of 32767...
Setting an EVAL scope, savestack=3
1 <a> <bc> | 4: PLUS
EXACT <b> can match 1 times out of 32767...
Setting an EVAL scope, savestack=3
2 <ab> <c> | 7: EXACT <c>
3 <abc> <> | 9: END
Match successful!
Freeing REx: `a*b+c'
If you have gotten this far into the tutorial, you can
probably guess what the different parts of the debugging
output tell you. The first part
Compiling REx `a*b+c'
size 9 first at 1
1: STAR(4)
2: EXACT <a>(0)
4: PLUS(7)
5: EXACT <b>(0)
7: EXACT <c>(9)
9: END(0)
perl v5.12.5 Last change: 2012-11-03 54
Perl Programmers Reference Guide PERLRETUT(1)
describes the compilation stage. STAR(4) means that there
is a starred object, in this case 'a', and if it matches,
goto line 4, i.e., PLUS(7). The middle lines describe some
heuristics and optimizations performed before a match:
floating `bc' at 0..2147483647 (checking floating) minlen 2
Guessing start of match, REx `a*b+c' against `abc'...
Found floating substr `bc' at offset 1...
Guessed: match at offset 0
Then the match is executed and the remaining lines describe
the process:
Matching REx `a*b+c' against `abc'
Setting an EVAL scope, savestack=3
0 <> <abc> | 1: STAR
EXACT <a> can match 1 times out of 32767...
Setting an EVAL scope, savestack=3
1 <a> <bc> | 4: PLUS
EXACT <b> can match 1 times out of 32767...
Setting an EVAL scope, savestack=3
2 <ab> <c> | 7: EXACT <c>
3 <abc> <> | 9: END
Match successful!
Freeing REx: `a*b+c'
Each step is of the form "n <x> <y>", with "<x>" the part of
the string matched and "<y>" the part not yet matched. The
"| 1: STAR" says that Perl is at line number 1 n the
compilation list above. See "Debugging regular expressions"
in perldebguts for much more detail.
An alternative method of debugging regexps is to embed
"print" statements within the regexp. This provides a blow-
by-blow account of the backtracking in an alternation:
"that this" =~ m@(?{print "Start at position ", pos, "\n";})
t(?{print "t1\n";})
h(?{print "h1\n";})
i(?{print "i1\n";})
s(?{print "s1\n";})
|
t(?{print "t2\n";})
h(?{print "h2\n";})
a(?{print "a2\n";})
t(?{print "t2\n";})
(?{print "Done at position ", pos, "\n";})
@x;
prints
perl v5.12.5 Last change: 2012-11-03 55
Perl Programmers Reference Guide PERLRETUT(1)
Start at position 0
t1
h1
t2
h2
a2
t2
Done at position 4
BUGS
Code expressions, conditional expressions, and independent
expressions are experimental. Don't use them in production
code. Yet.
ATTRIBUTES
See attributes(5) for descriptions of the following
attributes:
+---------------+------------------+
|ATTRIBUTE TYPE | ATTRIBUTE VALUE |
+---------------+------------------+
|Availability | runtime/perl-512 |
+---------------+------------------+
|Stability | Uncommitted |
+---------------+------------------+
SEE ALSO
This is just a tutorial. For the full story on Perl regular
expressions, see the perlre regular expressions reference
page.
For more information on the matching "m//" and substitution
"s///" operators, see "Regexp Quote-Like Operators" in
perlop. For information on the "split" operation, see
"split" in perlfunc.
For an excellent all-around resource on the care and feeding
of regular expressions, see the book Mastering Regular
Expressions by Jeffrey Friedl (published by O'Reilly, ISBN
1556592-257-3).
AUTHOR AND COPYRIGHT
Copyright (c) 2000 Mark Kvale All rights reserved.
This document may be distributed under the same terms as
Perl itself.
Acknowledgments
The inspiration for the stop codon DNA example came from the
ZIP code example in chapter 7 of Mastering Regular
Expressions.
perl v5.12.5 Last change: 2012-11-03 56
Perl Programmers Reference Guide PERLRETUT(1)
The author would like to thank Jeff Pinyan, Andrew Johnson,
Peter Haworth, Ronald J Kimball, and Joe Smith for all their
helpful comments.
NOTES
This software was built from source available at
https://java.net/projects/solaris-userland. The original
community source was downloaded from
http://www.cpan.org/src/5.0/perl-5.12.5.tar.bz2
Further information about this software can be found on the
open source community website at http://www.perl.org/.
perl v5.12.5 Last change: 2012-11-03 57